Gene SBF1 Variant 1
DNA : 28.23 KbNT_011526
mRNA : 5992 bp XM_037447
CDS : 5634 bp XP_037447
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  66 bp
ccggagccgtagtccaggtgcccggcccgaggggcggtgctcgggccccagagtggtcag
cgatgggcggggcgctgctctcgggagccgccctcccaccctctggaccaatggagatgc
gcggttgcaggccccgcccgctcagggcttgacgacagcgcgcaggcgcacggcgcgccc
GGGCGGGCCGGCTGGCTGGGAAGATGGCGGCGGGAACCTGGGCCGCCGCCGCCGCCGCCG
CCGCCG
ccgcggagcgaaccaggggtgtccggggtgcgcggtccagggccggggccgggccatgag
cgcgccgtcctcgagtccccgagccgcggagcccgcccgcgcccctcgggccgccccgcg
tccctcgccatggcgcggctcgcggactacttcgtgctggtggcgttcgggccgcacccg
EXON 2  42 bp
ggcgggaacctgggccgccgccgccgccgccgccgccgccgcggagcgaaccaggggtgt
ccggggtgcgcggtccagggccggggccgggccatgagcgcgccgtcctcgagtccccga
gccgcggagcccgcccgcgcccctcgggccgccccgcgtccctcgccatggcgcggctcg
CGGACTACTTCGTGCTGGTGGCGTTCGGGCCGCACCCGCGCG
gtgagtgccgaggccaagcgctgagggccgggggccgagggtcgagtgctgagggccagg
ggctgggtctgagggtcgagggccgggggctgggggccgagggctgggggctgggtcggg
aggccgaggactgagggccgggcgctgagggccgaggaccgggggctgggcgctgagggc
EXON 3  86 bp
ggccctggggtctgcagctgtcaagcagactctccatacggagctatttttagggagctg
tggctgatctggtgccagatgagggcccagtgggtgggaatgtttccaccctgggatcct
caagcctcctggtgggtggggggcgggttgggtgctctgaccccctgttcttgtcctcag
GGAGTGGGGAAGGCCAGGGCCAGATTCTGCAGCGCTTCCCAGAGAAGGACTGGGAGGACA
ACCCATTCCCCCAGGGCATCGAGCTG
gtgagttgggggcgtgctgagacggtgctggcaggtggggagggcaggtgggcacagccc
tgcccttgtccctgactgaggggcctccacagtgcccggccccccgctgggctagggaca
agacagcagagcctctgtcggggggtttgaccggcttggccggcggcctgtgcggtgctc
EXON 4  138 bp
ttactcccttcacccggagagactgaggcccaggaggccacgtgtccccagggtctccaa
gcaaggagctgcctgtgtgtgttggagcctccaggcctggtggtgcagatgctggggcgg
gtgggctggttcctgccacaggtgtagggggaggagctgactgctgagccttccctgcag
TTTTGCCAGCCCAGCGGGTGGCAGCTGTGTCCCGAGAGGAATCCACCGACCTTCTTTGTT
GCTGTCCTCACCGACATCAACTCCGAGCGCCACTACTGCGCCTGCTTGACCTTCTGGGAG
CCAGCGGAGCCTTCACAG
gtcagcttggggcctctgggtacagcatgaatgaagctgcatccttgggccgtggccaac
tccccctgcccccgtctccccctgacccccagcaggaaacgacgcgcgtggaggatgcca
cagagagggaggaagagggggatgagggaggccagacccacctgtctcccacagcacctg
EXON 5  159 bp
ctttgttgctgtcctcaccgacatcaactccgagcgccactactgcgcctgcttgacctt
ctgggagccagcggagccttcacaggtcagcttggggcctctgggtacagcatgaatgaa
gctgcatccttgggccgtggccaactccccctgcccccgtctccccctgacccccagcag
GAAACGACGCGCGTGGAGGATGCCACAGAGAGGGAGGAAGAGGGGGATGAGGGAGGCCAG
ACCCACCTGTCTCCCACAGCACCTGCCCCATCTGCCCAGCTGTTTGCACCGAAGACGCTG
GTACTGGTGTCGCGACTCGACCACACGGAGGTGTTCAGG
gtgaggccggcagccggggcggcgaggcacgacgagggtgcttccatcggctgtcccacc
actccccgctctggtcattgcagaacagccttggcctcatctatgccatccacgtggagg
gcctgaatgtgtgcctggagaacgtgattgggaacctgctgacgtgcactgtgcccctgg
EXON 6  111 bp
ccacctgtctcccacagcacctgccccatctgcccagctgtttgcaccgaagacgctggt
actggtgtcgcgactcgaccacacggaggtgttcagggtgaggccggcagccggggcggc
gaggcacgacgagggtgcttccatcggctgtcccaccactccccgctctggtcattgcag
AACAGCCTTGGCCTCATCTATGCCATCCACGTGGAGGGCCTGAATGTGTGCCTGGAGAAC
GTGATTGGGAACCTGCTGACGTGCACTGTGCCCCTGGCTGGGGGCTCGCAG
gtgagttttggaggcagctggtatctgcacagccacaggccctcctgctggggccctggt
aggtatttggagcccagccagagccacacacagctggaggccttggatgctccctcttgc
gtcctcgtgccaccattgcccccaacagtcctggcctgcttacctggccctcgcacctgt
EXON 7  106 bp
cagctgcttgggacaacagaggcagggcatggcgtttccctcttgccatgttgcccatcc
cagccagtcccacctcgggtctgtcagtacaccagggtctgcctggggacacagagctct
gggctgactctgggctggctctggccaaactactgagccccgatcctttttttgctgcag
AGGACGATCTCTTTGGGGGCTGGTGACCGGCAGGTCATCCAGACTCCACTGGCCGACTCG
CTGCCCGTCAGCCGCTGCAGCGTGGCCCTGCTCTTCCGCCAGCTAG
gtgagcctgtctgtcccacccccgcatggcttcccctcggggactggtagttagggatgt
gggttctcactctgcctgggtgggggcccagggtcctctccaagcttctcttcttccttt
aggcatcaccaacgtgctgtctttgttctgtgccgccctcacggagcacaaggttctctt
EXON 8  133 bp
ctggccgactcgctgcccgtcagccgctgcagcgtggccctgctcttccgccagctaggt
gagcctgtctgtcccacccccgcatggcttcccctcggggactggtagttagggatgtgg
gttctcactctgcctgggtgggggcccagggtcctctccaagcttctcttcttcctttag
GCATCACCAACGTGCTGTCTTTGTTCTGTGCCGCCCTCACGGAGCACAAGGTTCTCTTCC
TGTCCCGGAGCTACCAGCGGCTCGCCGATGCCTGTAGGGGCCTCCTGGCACTGCTGTTTC
CTCTCAGATACAG
gtgacccctgcccggccctcccagccccttctcctggcccctttgcccagccgcgtcccc
tggctcactgcatcctctggggcctgcacagcttcacctatgtgcccatcctgccggctc
agctgctggaggtcctcagcacacccacgcccttcatcattggggtcaacgcggccttcc
EXON 9  109 bp
cacaaggttctcttcctgtcccggagctaccagcggctcgccgatgcctgtaggggcctc
ctggcactgctgtttcctctcagatacaggtgacccctgcccggccctcccagccccttc
tcctggcccctttgcccagccgcgtcccctggctcactgcatcctctggggcctgcacag
CTTCACCTATGTGCCCATCCTGCCGGCTCAGCTGCTGGAGGTCCTCAGCACACCCACGCC
CTTCATCATTGGGGTCAACGCGGCCTTCCAGGCAGAGACCCAGGAGCTG
gtaagggctgtgctttgtgtccacctcacggcccaggcctgcaggtccctgactgccggc
tcccttggtccgcagctcgatgtgattgttgctgatctggatggagggacggtcaccatt
cctgagtgtgtgcacattccacccttgccagagccactgcagagtcagacgcacagtgtg
EXON 10  114 bp
acctatgtgcccatcctgccggctcagctgctggaggtcctcagcacacccacgcccttc
atcattggggtcaacgcggccttccaggcagagacccaggagctggtaagggctgtgctt
tgtgtccacctcacggcccaggcctgcaggtccctgactgccggctcccttggtccgcag
CTCGATGTGATTGTTGCTGATCTGGATGGAGGGACGGTCACCATTCCTGAGTGTGTGCAC
ATTCCACCCTTGCCAGAGCCACTGCAGAGTCAGACGCACAGTGTGCTGAGCATG
gtgaggggcaccatgggcaagcgggagccttgggggcctttgggatgtggctacctggca
gcacggggagcctagagccggggccagcgtgcagctgcctgctccattctgtgctggcag
gtcctggacccggagctggagttggctgacctcgccttccctccgcccacgacatccacc
EXON 11  78 bp
gtgcacattccacccttgccagagccactgcagagtcagacgcacagtgtgctgagcatg
gtgaggggcaccatgggcaagcgggagccttgggggcctttgggatgtggctacctggca
gcacggggagcctagagccggggccagcgtgcagctgcctgctccattctgtgctggcag
GTCCTGGACCCGGAGCTGGAGTTGGCTGACCTCGCCTTCCCTCCGCCCACGACATCCACC
TCCTCCCTGAAGATGCAG
gtgggggtcgttgctgctcctgcatggggaccccaggcacttaggctgcccccactcagg
tctgctgccactgacacacagggccccacccccaggctggccccggctccagtagcagaa
gcaggagcctgggagcaaagcagctgccagcagttaggagtggtggtcgtgagtggtgca
EXON 12  114 bp
aggagtgccttgtccagacagtttcagaggagctggtggccctgagtgcagaatggtggg
aggggcagaaggatgggagcggggcagcttggggtgggttggggtgtggagaagctcctg
ggcagcctggggtggggattggcaggactggctctcacctgcactcagctcttctcccag
GACAAGGAGCTGCGCGCGGTCTTCCTGCGGCTGTTCGCTCAGCTGCTGCAGGGCTATCGC
TGGTGCCTGCACGTCGTGCGCATCCACCCGGAGCCTGTCATCCGCTTCCATAAG
gtggggtgcctggtggctgggcgtggggtaggagataagcgcatggtggagacccctgag
ggaccgacctccttctgtcatccaggcagccttcctgggccagcgtgggctggtagagga
cgatttcctgatgaaggtgctggagggcatggcctttgctggctttgtgtcagagcgtgg
EXON 13  129 bp
tcttcctgcggctgttcgctcagctgctgcagggctatcgctggtgcctgcacgtcgtgc
gcatccacccggagcctgtcatccgcttccataaggtggggtgcctggtggctgggcgtg
gggtaggagataagcgcatggtggagacccctgagggaccgacctccttctgtcatccag
GCAGCCTTCCTGGGCCAGCGTGGGCTGGTAGAGGACGATTTCCTGATGAAGGTGCTGGAG
GGCATGGCCTTTGCTGGCTTTGTGTCAGAGCGTGGGGTCCCATACCGCCCTACGGACCTG
TTCGATGAG
gtgcacctccaccctgccctcccagccccctgccctggctccgcctgaccatggcttacc
taacctcctgcttaccccgctagctggtggcccacgaggtggcaaggatgcgggcggatg
agaaccacccccagcgtgtcctgcgtcacgtccaggaactggcagagcagctctacaaga
EXON 14  99 bp
ggacgatttcctgatgaaggtgctggagggcatggcctttgctggctttgtgtcagagcg
tggggtcccataccgccctacggacctgttcgatgaggtgcacctccaccctgccctccc
agccccctgccctggctccgcctgaccatggcttacctaacctcctgcttaccccgctag
CTGGTGGCCCACGAGGTGGCAAGGATGCGGGCGGATGAGAACCACCCCCAGCGTGTCCTG
CGTCACGTCCAGGAACTGGCAGAGCAGCTCTACAAGAAC
gtacgagggtagcaggacgggagggcgtcgtaccgccttgatccctgggcccctgcccca
cacctgccgtctccccacaggagaacccgtacccagccgtggcgatgcacaaggtacaga
ggcccggtgagagcagccacctgcgacgggtgccccgacccttcccccggctggatgagg
EXON 15  205 bp
gctggtggcccacgaggtggcaaggatgcgggcggatgagaaccacccccagcgtgtcct
gcgtcacgtccaggaactggcagagcagctctacaagaacgtacgagggtagcaggacgg
gagggcgtcgtaccgccttgatccctgggcccctgccccacacctgccgtctccccacag
GAGAACCCGTACCCAGCCGTGGCGATGCACAAGGTACAGAGGCCCGGTGAGAGCAGCCAC
CTGCGACGGGTGCCCCGACCCTTCCCCCGGCTGGATGAGGGCACCGTGCAGTGGATCGTG
GACCAGGCTGCAGCCAAGATGCAGGGTGCACCCCCAGCTGTGAAGGCCGAGAGGAGGACC
ACCGTGCCCTCAGGGCCCCCCATGA
gtgcgtaatgagggaggggaaggcaggccccgagcgtggcccaggatgggcgtggggtca
ggggtccgagtgtgtgtattctgtccccgcagctgccatactggagcggtgcagtgggct
gcatgtcaacagcgcccggcggctggaggttgtgcgcaactgcatctcctacgtgtttga
EXON 16  113 bp
gtggaccaggctgcagccaagatgcagggtgcacccccagctgtgaaggccgagaggagg
accaccgtgccctcagggccccccatgagtgcgtaatgagggaggggaaggcaggccccg
agcgtggcccaggatgggcgtggggtcaggggtccgagtgtgtgtattctgtccccgcag
CTGCCATACTGGAGCGGTGCAGTGGGCTGCATGTCAACAGCGCCCGGCGGCTGGAGGTTG
TGCGCAACTGCATCTCCTACGTGTTTGAGGGGAAAATGCTTGAGGCCAAGAAG
gtgagggctgtgcaggctccagccgggccagggcagcgggtttcagaggagacccaggct
gcacttcacccttgtgagtgctgacgctgccccagggcctcctctgcctaacagacagct
agaggtggctgggctggccggagggtaggtgggctccaggtctcctctcttgacctcagt
EXON 17  150 bp
cttgtggagttgtcgggcccactggaggttttagtctttattggtcggcaaagccccaga
gtctggcacaccccacctgaaaggcatttgggtctcctggacacctgctgccctccctgc
cagggccccgagtgggtcttctctgtgccctcagcccgtgtctcctttccccacccccag
CTGCTCCCAGCCGTGTTGAGGGCCCTGAAGGGGCGAGCTGCCCGCCGCTGCCTCGCCCAG
GAGCTGCACCTGCATGTGCAGCAGAACCGTGCGGTCCTGGACCACCAGCAGTTTGACTTT
GTCGTCCGTATGATGAACTGCTGCCTGCAG
gtgaggcctcttatcctgctagtgacatggctcatggcgcatgagcgggaacaggcgggc
agaccctggtctgtgagtgagagtggagagacggtgcaagagactcctgtgccagtgggc
aggggtcctcggtctgcagggaacagggtggagagaaccattgttgggggcaggtgctgg
EXON 18  69 bp
tgggggcaggtgctggggcctggggtctcctgatattgagcctctgaggcagccttgggg
agctggagccaagggtgtcaggtgctggtctgtggtggttatggggtggtgggggcatgg
tgggaggtgagtgctgcctgggaggggagaggtcctgacggtctctcgctctacctgcag
GACTGCACTTCTCTGGACGAGCATGGCATTGCGGCGGCTCTGCTGCCTCTGGTCACAGCC
TTCTGCCGG
gtgagtgctggcatggctgaggtctccttcccagcccccccttcctggtggctgaggtct
ccttcccagccccccttcctggtggccgaggtctccttcccagccgcccttcctggctgc
atccagctgaccttctcccctggctcctgcagaagctgagcccgggggtgacgcagtttg
EXON 19  159 bp
gctgcctctggtcacagccttctgccgggtgagtgctggcatggctgaggtctccttccc
agcccccccttcctggtggctgaggtctccttcccagccccccttcctggtggccgaggt
ctccttcccagccgcccttcctggctgcatccagctgaccttctcccctggctcctgcag
AAGCTGAGCCCGGGGGTGACGCAGTTTGCATACAGCTGTGTGCAGGAGCACGTGGTGTGG
AGCACGCCACAGTTCTGGGAGGCCATGTTCTATGGGGATGTGCAGACTCACATCCGGGCC
CTCTACCTGGAGCCCACGGAGGACCTGGCCCCCGCCCAG
gtgcgcagggactccctgggctgggggctgggggctaggggctggggcagcgtggccccg
gctcatgcgtgtggtgccgtggcaggaggttggggaggcaccttcccaggaggacgagcg
ctctgccctagacgtggcttctgagcagcggcgcttgtggccaactctgagtcgtgagaa
EXON 20  269 bp
cgccacagttctgggaggccatgttctatggggatgtgcagactcacatccgggccctct
acctggagcccacggaggacctggcccccgcccaggtgcgcagggactccctgggctggg
ggctgggggctaggggctggggcagcgtggccccggctcatgcgtgtggtgccgtggcag
GAGGTTGGGGAGGCACCTTCCCAGGAGGACGAGCGCTCTGCCCTAGACGTGGCTTCTGAG
CAGCGGCGCTTGTGGCCAACTCTGAGTCGTGAGAAGCAGCAGGAGCTGGTGCAGAAGGAG
GAGAGCACGGTGTTCAGCCAGGCCATCCACTATGCCAACCGCATGAGCTACCTCCTCCTG
CCCCTGGACAGCAGCAAGAGCCGCCTACTTCGGGAGCGTGCCGGGCTGGGCGACCTGGAG
AGCGCCAGCAACAGCCTGGTCACCAACAG
gtgaggcagggactgggggttgggcccagtggaggcggggccgtggtgggcagggcccat
gcccacagtttcttctctggcccagcatggctggcagtgtggccgagagctatgacacgg
agagcggcttcgaggatgcagagacctgcgacgtagctggggctgtggtccgcttcatca
EXON 21  173 bp
ctcctgcccctggacagcagcaagagccgcctacttcgggagcgtgccgggctgggcgac
ctggagagcgccagcaacagcctggtcaccaacaggtgaggcagggactgggggttgggc
ccagtggaggcggggccgtggtgggcagggcccatgcccacagtttcttctctggcccag
CATGGCTGGCAGTGTGGCCGAGAGCTATGACACGGAGAGCGGCTTCGAGGATGCAGAGAC
CTGCGACGTAGCTGGGGCTGTGGTCCGCTTCATCAACCGCTTTGTGGACAAGGTCTGCAC
GGAGAGTGGGGTCACCAGCGACCACCTCAAGGGGCTGCATGTCATGGTGCCAG
gtacgggggtttgggctggtgattcccccttggatgggtggggctgggcacaaagtgtga
gaactgtcttcccccagacattgtccagatgcacatcgagaccctggaggccgtgcagcg
ggagagccggaggctgccgcccatccagaaggtttgcgggggccgttggggctgcggggg
EXON 22  74 bp
gctggggctgtggtccgcttcatcaaccgctttgtggacaaggtctgcacggagagtggg
gtcaccagcgaccacctcaaggggctgcatgtcatggtgccaggtacgggggtttgggct
ggtgattcccccttggatgggtggggctgggcacaaagtgtgagaactgtcttcccccag
ACATTGTCCAGATGCACATCGAGACCCTGGAGGCCGTGCAGCGGGAGAGCCGGAGGCTGC
CGCCCATCCAGAAG
gtttgcgggggccgttggggctgcgggggcccaaggcccgggctgcatcctgagctcctg
ctcttgttttcgagcagcccaagctgctgcggccgcgcctgctgccgggtgaggagtgtg
tgctggacggcctgcgcgtctacctgctgccggatgggcgtgaggagggcgcggggggca
EXON 23  196 bp
cacaaagtgtgagaactgtcttcccccagacattgtccagatgcacatcgagaccctgga
ggccgtgcagcgggagagccggaggctgccgcccatccagaaggtttgcgggggccgttg
gggctgcgggggcccaaggcccgggctgcatcctgagctcctgctcttgttttcgagcag
CCCAAGCTGCTGCGGCCGCGCCTGCTGCCGGGTGAGGAGTGTGTGCTGGACGGCCTGCGC
GTCTACCTGCTGCCGGATGGGCGTGAGGAGGGCGCGGGGGGCAGTGCTGGGGGACCAGCA
TTGCTCCCAGCTGAGGGCGCCGTCTTCCTCACCACGTACCGGGTCATCTTCACGGGGATG
CCCACGGACCCCCTGG
gtgagcctgcagactctctggccctgtcgccccctctcccccaggtctttgggatggatg
ggctttccctgcctccctctcccttttctcgggggttctgggtgcccgtgggaaacgggc
ctttgtctgctccttccccacccacttgggattccccataactgtggtaccctgagattc
EXON 24  128 bp
gatgggctttccctgcctccctctcccttttctcgggggttctgggtgcccgtgggaaac
gggcctttgtctgctccttccccacccacttgggattccccataactgtggtaccctgag
attctgggacccccccccccttaccttccttgcttctgactctgcctggcctgtcctaag
TTGGGGAGCAGGTGGTGGTCCGCTCCTTCCCGGTGGCTGCGCTGACCAAGGAGAAGCGCA
TCAGCGTCCAGACCCCTGTGGACCAGCTCCTGCAGGACGGGCTCCAGCTGCGCTCCTGCA
CATTCCAG
gtggggcgcggtgcgcgggtggggctctcatcccccgccctggtctttctcctgcaaacc
ggtctttcttgtatgaaccatttttaggccagtctccagcagtggccctgttgttacgct
tgcatgtctggggccctcactgtggctcttgagttgatgtccactgtttgatgtgcggtc
EXON 25  179 bp
cactgagatttcgagtttacacaagcgcttgccttcgtgtgacacagatacaggcctttg
cctggggcctgcttctctctctgtcatggctgcgaggggaaggggagcctggcagtgtca
gagttgggggaggggctggggggccacccacacccctaagggctgcttttactgacacag
CTGCTGAAAATGGCCTTTGACGAGGAGGTGGGGTCTGACAGCGCCGAGCTCTTCCGTAAG
CAGCTGCATAAGCTGCGGTACCCGCCGGACATCAGGGCCACCTTTGCGTTCACCTTGGGC
TCTGCCCACACACCTGGCCGGCCACCGCGAGTCACCAAGGACAAGGGTCCTTCCCTCAG
gtatggatctgggtcccaggcagggcagctgggcctcagccgtgttcccgctccaaccct
cctaggcccctgtgctcatctttgtccctcctcctctcacctttgctgactctcgtgggc
ctcagaaccctgtcccggaacctggtcaagaacgccaagaagaccatcgggcggcagcat
EXON 26  137 bp
cccacacacctggccggccaccgcgagtcaccaaggacaagggtccttccctcaggtatg
gatctgggtcccaggcagggcagctgggcctcagccgtgttcccgctccaaccctcctag
gcccctgtgctcatctttgtccctcctcctctcacctttgctgactctcgtgggcctcag
AACCCTGTCCCGGAACCTGGTCAAGAACGCCAAGAAGACCATCGGGCGGCAGCATGTCAC
TCGCAAGAAGTACAACCCCCCCAGCTGGGAGCACCGGGGCCAGCCGCCCCCTGAGGACCA
GGAGGACGAGATCTCAG
gtggaggggtgggggtggagtcctgggtggtctctggatgctgacattggccagggagga
tcagggcaggcggagtggccccgtgatgaccacgtgtgcccggcctgtgcagtgtcggag
gagctggagcccagcacgctgaccccgtcctcagccctgaagccctccgaccgcatgacc
EXON 27  208 bp
gtacaacccccccagctgggagcaccggggccagccgccccctgaggaccaggaggacga
gatctcaggtggaggggtgggggtggagtcctgggtggtctctggatgctgacattggcc
agggaggatcagggcaggcggagtggccccgtgatgaccacgtgtgcccggcctgtgcag
TGTCGGAGGAGCTGGAGCCCAGCACGCTGACCCCGTCCTCAGCCCTGAAGCCCTCCGACC
GCATGACCATGAGCAGCCTGGTGGAAAGGGCTTGCTGTCGCGACTACCAGCGCCTCGGTC
TGGGCACCCTGAGCAGCAGCCTGAGCCGGGCCAAGTCTGAGCCCTTCCGCATTTCTCCGG
TCAACCGCATGTATGCCATCTGCCGCAG
gtgagggccggccagggctggcccgggtggtggacacgtgactgggtgtcttccctgccc
gctgtgggcctgggccacggcttctggtcatgtaaggaatgtggagggggagactccggg
cagagggacgggccacagggctggggggtggctggggggccccgtggctgagctggaagc
EXON 28  197 bp
gggggagactccgggcagagggacgggccacagggctggggggtggctggggggccccgt
ggctgagctggaagcgcctcctgctgggagccatgggctggctcctcttgccctgcttgg
ggcgtgagcctggaggcgggtggggtcgccagccaccttcacgcctctgcctcctctcag
CTACCCAGGGCTGCTGATCGTGCCCCAGAGTGTCCAGGACAACGCCCTGCAGCGCGTGTC
CCGCTGCTACCGCCAGAACCGCTTCCCCGTGGTCTGCTGGCGCAGCGGGCGGTCCAAGGC
GGTGCTGCTGCGCTCTGGAGGCCTGCATGGCAAAGGTGTCGTCGGCCTCTTCAAGGCCCA
GAACGCACCTTCTCCAG
gtacctcctgcgtcctgccctgtgcctgccctgccctatctcaccctcccctccctcagc
tccgtgtcctcccccaggccagtcccaggcggactcgagtagcctggagcaggagaagta
cctgcaggctgtggtcagctccatgccccgctacgccgacgcgtcgggacgcaacacgct
EXON 29  138 bp
tgctggcgcagcgggcggtccaaggcggtgctgctgcgctctggaggcctgcatggcaaa
ggtgtcgtcggcctcttcaaggcccagaacgcaccttctccaggtacctcctgcgtcctg
ccctgtgcctgccctgccctatctcaccctcccctccctcagctccgtgtcctcccccag
GCCAGTCCCAGGCGGACTCGAGTAGCCTGGAGCAGGAGAAGTACCTGCAGGCTGTGGTCA
GCTCCATGCCCCGCTACGCCGACGCGTCGGGACGCAACACGCTTAGCGGCTTCTCCTCAG
CCCACATGGGCAGTCACG
gtgagggtgcttgtgggcagacggtggggcaggggcactttggggggccgtggtggcatt
tatggtttggcaggcaggccagggaggagcagaaacggcgctggtcatggatgtttgggt
gtgggatgaggagcatgccctccgggtgccgtggggcaggggcgggaagcctgtccagac
EXON 30  182 bp
tgccaccccacgtctcagaatctgtgtgttccagccctcctctcgcacggccctgctggg
gtcctgccaaccacccctgccctgggagctcagccccctccctggaggccgggcccagcc
agccccaggtaagtggtgccctggccccctttgggtgcttacctggcatctccttcacag
GTAAGTGGGGCAGTGTCCGGACCAGTGGACGCAGCAGTGGCCTTGGCACCGATGTGGGCT
CCCGGCTAGCTGGCAGAGACGCGCTGGCCCCACCCCAGGCCAACGGGGGCCCTCCCGACC
CGGGCTTCCTGCGTCCGCAGCGAGCAGCCCTCTATATCCTTGGGGACAAAGCCCAGCTCA
AG
gtgactggggtgcggggggtggggggtgagggtgggggctcggcagggggcttggggcct
catgtgtctcacgggacttgtccggattcttttcagggtgtgcggtcagaccccctgcag
cagtgggagctggtgcccattgaggtattcgaggcacggcaggtgaaggctagcttcaag
EXON 31  180 bp
gccaacgggggccctcccgacccgggcttcctgcgtccgcagcgagcagccctctatatc
cttggggacaaagcccagctcaaggtgactggggtgcggggggtggggggtgagggtggg
ggctcggcagggggcttggggcctcatgtgtctcacgggacttgtccggattcttttcag
GGTGTGCGGTCAGACCCCCTGCAGCAGTGGGAGCTGGTGCCCATTGAGGTATTCGAGGCA
CGGCAGGTGAAGGCTAGCTTCAAGAAGCTGCTGAAAGCATGTGTCCCAGGCTGCCCCGCT
GCTGAGCCCAGCCCAGCCTCCTTCCTGCGCTCACTGGAGGACTCAGAGTGGCTGATCCAG

gtctctgcactgccccgtccctctgcccgccttggtgctgggccctccccttgggtagag
ccaagtggacgggtctaggtttgcttgtctgacagtgtggagcgctggaaggaggaggtg
acagccacttcccacccaggctctggtgcctagaaggcagctgggaggctgggcctggct
EXON 32  102 bp
tggtcggcacacccagagcgagctgtgtttgtccagtgctctgcccgcatacagggcttg
gggggctgtggacagggcctgcctccccgctgcctgtggacatgcgggtctctggcctgg
tgagtggccaggcgggagggcggtgggtccccgaggtgctgaggccgcctgtccctgcag
ATCCACAAGCTGCTGCAGGTGTCTGTGCTGGTGGTGGAGCTCCTGGATTCAGGCTCCTCC
GTGCTGGTGGGCCTGGAGGATGGCTGGGACATCACCACCCAG
gtgtgtggcgcgtggggctggggtgggccaggctcccgggctcctcgctgacctcctggc
ggtgctggcaggtggtatccttggtgcagctgctctcagaccccttctaccgcacgctgg
agggctttcgcctgctggtggagaaggagtggctgtccttcggccatcgcttcagccacc
EXON 33  186 bp
cctgcagatccacaagctgctgcaggtgtctgtgctggtggtggagctcctggattcagg
ctcctccgtgctggtgggcctggaggatggctgggacatcaccacccaggtgtgtggcgc
gtggggctggggtgggccaggctcccgggctcctcgctgacctcctggcggtgctggcag
GTGGTATCCTTGGTGCAGCTGCTCTCAGACCCCTTCTACCGCACGCTGGAGGGCTTTCGC
CTGCTGGTGGAGAAGGAGTGGCTGTCCTTCGGCCATCGCTTCAGCCACCGTGGAGCTCAC
ACCCTGGCCGGGCAGAGCAGCGGCTTCACACCCGTCTTCCTGCAGTTCCTGGACTGCGTA
CACCAG
gtgggcaggccgctgtgtgggtgggccgggactgtgcaccctgaccgctgagccctggcc
cctgacccacatggcgtgcaggtccacctgcagttccccatggagtttgagttcagccag
ttctacctcaagttcctcggctaccaccatgtgtcccgccgtttccggaccttcctgctc
EXON 34  127 bp
ttcggccatcgcttcagccaccgtggagctcacaccctggccgggcagagcagcggcttc
acacccgtcttcctgcagttcctggactgcgtacaccaggtgggcaggccgctgtgtggg
tgggccgggactgtgcaccctgaccgctgagccctggcccctgacccacatggcgtgcag
GTCCACCTGCAGTTCCCCATGGAGTTTGAGTTCAGCCAGTTCTACCTCAAGTTCCTCGGC
TACCACCATGTGTCCCGCCGTTTCCGGACCTTCCTGCTCGACTCTGACTATGAGCGCATT
GAGCTGG
gtatgtggggagtcggggctggggcagccacgggtcaggaggggcccaggctcagtgctg
cttctgtgcagggctgctgtatgaggagaagggggaacgcaggggccaggtgccgtgcag
gtctgtgtgggagtatgtggaccggctgagcaagaggacgcctgtgttccacaattacat
EXON 35  131 bp
atggagtttgagttcagccagttctacctcaagttcctcggctaccaccatgtgtcccgc
cgtttccggaccttcctgctcgactctgactatgagcgcattgagctgggtatgtgggga
gtcggggctggggcagccacgggtcaggaggggcccaggctcagtgctgcttctgtgcag
GGCTGCTGTATGAGGAGAAGGGGGAACGCAGGGGCCAGGTGCCGTGCAGGTCTGTGTGGG
AGTATGTGGACCGGCTGAGCAAGAGGACGCCTGTGTTCCACAATTACATGTATGCGCCCG
AGGACGCAGAG
gtaagctggggcctgggtcgggtaggcggctcctgcccgacccaggtcctcaaccacagg
cccaccctcaggtcctgcggccctacagcaacgtgtccaacctgaaggtgtgggacttct
acactgaggagacgctggccgagggccctccctatgactgggaactggcccaggggcccc
EXON 36  231 bp
ggaacgcaggggccaggtgccgtgcaggtctgtgtgggagtatgtggaccggctgagcaa
gaggacgcctgtgttccacaattacatgtatgcgcccgaggacgcagaggtaagctgggg
cctgggtcgggtaggcggctcctgcccgacccaggtcctcaaccacaggcccaccctcag
GTCCTGCGGCCCTACAGCAACGTGTCCAACCTGAAGGTGTGGGACTTCTACACTGAGGAG
ACGCTGGCCGAGGGCCCTCCCTATGACTGGGAACTGGCCCAGGGGCCCCCTGAACCCCCA
GAGGAAGAACGGTCTGATGGAGGCGCTCCCCAGAGCAGGCGCCGCGTGGTGTGGCCCTGT
TACGACAGCTGCCCGCGGGCCCAGCCTGACGCCATCTCACGCCTGCTGGAG
gtgcgtgtgatcccagagcagggtctggcctggcacccccctcctctcgctcagacacca
gggtcgtgcgtgtgtgtgtacactcgtacatgcacgtaagtccggttacccctgggggtt
ggtgtggccctgccgtctccccaccatgtgaactgcctactggcctggggtggctgtggc
EXON 37  108 bp
ttgtctccgaatattcattttgcatattccttccctccctcttgccacctccccctgtgg
ccagtcacacacgcgttaggcctttccgttgtgtctctttcctgtgttttccttttgtct
tttcgtgctctagtctggatatttccttttgaataaacttgccattaattcttcccccag
GAGCTGCAGAGGCTGGAGACAGAGTTGGGCCAACCCGCTGAGCGCTGGAAGGACACCTGG
GACCGGGTGAAGGCTGCACAGCGCCTCGAGGGCCGGCCAGACGGCCGT
gtgagtgagggccagtgtgagcgtccacggtgggcgtgttgctgggagaaagtggagtct
gtccagccctgacccaagtcccaacctcctgttcccagggcacccctagctccctccttg
tgtccaccgcaccccaccaccgtcgctcgctgggtgtgtacctgcaggaggggcccgtgg
EXON 38  212 bp
gggccaacccgctgagcgctggaaggacacctgggaccgggtgaaggctgcacagcgcct
cgagggccggccagacggccgtgtgagtgagggccagtgtgagcgtccacggtgggcgtg
ttgctgggagaaagtggagtctgtccagccctgacccaagtcccaacctcctgttcccag
GGCACCCCTAGCTCCCTCCTTGTGTCCACCGCACCCCACCACCGTCGCTCGCTGGGTGTG
TACCTGCAGGAGGGGCCCGTGGGCTCCACCCTGAGCCTCAGCCTGGACAGCGACCAGAGT
AGTGGCTCAACCACATCCGGCTCCCGTCAGGCTGCCCGCCGCAGCACCAGCACCCTGTAC
AGCCAGTTCCAGACAGCAGAGAGTGAGAACAG
gtatgagggcacctcccactgccacatggacacctctgagctggtgttctggggtcccag
gcagtcctctggtgggagattgcgggtgcttttgaggagcttgcttaagtatacaccacc
actgggaggggtttggggtgtcgaactggtgaccacagctgaccacagcctgcagtggct
EXON 39  88 bp
ccccccatcaaaggcttctttgtggccccctggccagtgctctgggcttaggtcagttct
ggggacagggtgcctggtcttacctcctgggctgggacagcaagggggggacgactgctg
gggcctgggcttggctgggccatgacggtcagcctggccctggttctgctggaaatgcag
GTCCTACGAGGGCACTCTGTACAAGAAGGGGGCCTTCATGAAGCCTTGGAAGGCCCGCTG
GTTCGTGCTGGACAAGACCAAGCACCAG
gtgagtgatcaggtggtgggggggactcacgggggagggggctccgctgactctgtggcc
tcctccagctgcgctactacgaccaccgtgtggacacagagtgcaagggtgtcatcgact
tggcggaggtggaggctgtggcacctggcacgcccactatgggtgcccctaagactgtgg
EXON 40  132 bp
gccctggttctgctggaaatgcaggtcctacgagggcactctgtacaagaagggggcctt
catgaagccttggaaggcccgctggttcgtgctggacaagaccaagcaccaggtgagtga
tcaggtggtgggggggactcacgggggagggggctccgctgactctgtggcctcctccag
CTGCGCTACTACGACCACCGTGTGGACACAGAGTGCAAGGGTGTCATCGACTTGGCGGAG
GTGGAGGCTGTGGCACCTGGCACGCCCACTATGGGTGCCCCTAAGACTGTGGACGAGAAG
GCCTTCTTTGAC
gtgagccttggccggggcttgggagaggggaggggctctgcggtgtgggggctgcggagt
cagtaacccgcccttccccaggtgaagacaacgcgtcgcgtttacaacttctgtgcccag
gacgtgccctcggcccagcagtgggtggaccggatccagagctgcctgtcggacgcctga
EXON 41  434 bp
tgcaagggtgtcatcgacttggcggaggtggaggctgtggcacctggcacgcccactatg
ggtgcccctaagactgtggacgagaaggccttctttgacgtgagccttggccggggcttg
ggagaggggaggggctctgcggtgtgggggctgcggagtcagtaacccgcccttccccag
GTGAAGACAACGCGTCGCGTTTACAACTTCTGTGCCCAGGACGTGCCCTCGGCCCAGCAG
TGGGTGGACCGGATCCAGAGCTGCCTGTCGGACGCCTGAGCCTCCCAGCCCTGCCCGGCT
GCTCTGCTTCCGGTCGTTACCGACCACTAGGGGTGGGCAGGGCCGCCCCGGCCATGTTTA
CAGCCCCGGCCCTCGACAGTATTGAGGCCCCGAGCCCCCAGCACTTGTGTGTACAGCCCC
CGTCCCCGCCCCGCCCCGCCCGGCCGGCCCTAACTTATTTTGGCGTCACAGCTGAGCACC
GTGCCGGGAGGTGGCCAAGGTACAGCCCGCAATGGGCCTGTAAATAGTCCGGCCCCGTCA
GCGTGTGCTGGTCCAGCCAGCGGCTGCAGGCGAGTTTCTAGAACCAGAGTCTATATAAAG
AGAGAACTAACGCC
acgctcctgtgcctgccttccccactccccggctgcctgctctcggcctacccagagggt
cccatctgcccctatccaggcccacctggcgggaggttggcatctttctcgtgagcctct
cctggtgcctgggtccacccagctcggcctgcatgtccctgggagtgactttgctctggg