Gene PVALB Variant 1
DNA : 18.62 KbNT_011520
mRNA : 424 bp NM_002854
CDS : 333 bp NP_002845
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  49 bp
ctgatgggcccagggaggctgaatgtgatacagacacccagcaccacggttggggagtac
ctgacaccggaaggggagggggccggggctacggggagtgccacctcccaaaatagccag
agcagaagcctatataggtggccatcccacctccaggctcacttcccgacaggacttccc
ACCAGCCCAGCCTTTCAGTGCAGGCTCCAGCCCTCCACCCCCACCCGAG
gtgagtggcagctaccgaggttggaggatagagggatgcagcaggatgagccagctggaa
gggagagctacatctcccctgtccgtagtgacccggggaggggggtgcggtgggggtgct
ggaggcagggcagctgtggaatgtagggctgagagcatgcattcctgcttctccacccag
EXON 2  68 bp
gctcagcggcgcggctggactgagccgctcccgctgcgctcagagtccgggcccctggcg
ccatgccaggcccggcgggcgtgcgcccggcgcgcagcactgcagcgctggtcatatgag
cagaaatgatgagaaaagcactttttaatcttttcgcacttgctctgcccgctcaaacag
TTGCAGGATGTCGATGACAGACTTGCTGAACGCTGAGGACATCAAGAAGGCGGTGGGAGC
CTTTAGCG
gtgagcaagcgcgctcccctccccatccctctcccctcgtccaccgcccgcgcccctgca
ctccgccggccccgcagccggcggatcctccccagcgcgcttctgcccacacttcccgct
gggcgccggcgaggtcggggcgggggcgtccttggcagttcccaaactctgtccgggcga
EXON 3  133 bp
cttggacaggttatcctcccttgcccgggctccctcagccctccaatggaggtgggtacc
tctcattccccatgactggcatgtgggaatccatcaacaaatgccttgatgccccccatt
ctcccaggcttccctaccagcctttctggtccttgtttgaccctgctcttccccccacag
CTACCGACTCCTTCGACCACAAAAAGTTCTTCCAAATGGTCGGCCTGAAGAAAAAGAGTG
CGGATGATGTGAAGAAGGTGTTTCACATGCTGGACAAGGACAAAAGTGGCTTCATCGAGG
AGGATGAGCTGGG
gtaagcggaggcctgcaggggctgcccagcccacggctgcacgagagggagtgggggctg
ggactctagcttccaagtgtccatcagacctgcctttcactctgcctgcttcacagaaag
taaccgtgcgtgaaggcagggctccgacccagggcaccaggggagaaggcttcctggtgc
EXON 4  110 bp
acgaaagcacagccaccgagcaggctacctggcccagagcatccgtgtgcgtgactgctg
ctcgctgcctgtcccagccatccctttccccatacagaaaccagaccaccctccatccag
cgtcctgcaaggcgacctcggcctgactccctcaccggctttctcccttttctcctccag
ATTCATCCTAAAAGGCTTCTCCCCAGATGCCAGAGACCTGTCTGCTAAAGAAACCAAGAT
GCTGATGGCTGCTGGAGACAAAGATGGGGACGGCAAAATTGGGGTTGACG
gtgggtagccgtgacctggggtctgggcatattgtggatcttggggtgttggatgcgaaa
agtttgaagctatgtctgtcacaaggaagggatgatatgggggtccctcactcccccaga
ttagaagacaaaaagcagtccattaggtctgagagctctgccacatactccagacaaagg
EXON 5  64 bp
tcactcatctgctcattcattcatttattcattcattcattttcacacttacgctctggg
gctgctgcagcagaagcaagaacccagagagagcaccacccagggccccgcagtcaggtg
tggacagtctctcttgcatccccgcctctgactcactttccttgtcattttgttctgcag
AATTCTCCACTCTGGTGGCTGAAAGCTAAGAAGCACTGACTGCCCCTGGTCTTCCACCTC
TCTG
ccctgaacacccaatctcggcccctctcgccaccctcctgcatttctgttcagttcgttt
atgttattttttactcccccatcccctgtggccctctaatgacaccattcttctggaaaa
tgctggagaagcaataaaggttgtaccagtcagactctgcttgctcaggaagacccaggc