Gene PRODH Variant 1
DNA : 23.77 KbNT_011519
mRNA : 2400 bp NM_016335
CDS : 1803 bp NP_057419
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  164 bp
gacacataataattgtacatatttgtggggtacgtagtgatgtttctgtacgtgtatagt
gatcagataagggtaattagcatacctatcatctcaaacatttattatttctttgcatta
cgaacactcaatattctccttcaagctatctgaaaatacataatttttgttttgagacag
GGTCTCACTCTGTTGCTGTCTTCACGGAGAGCAGGAGCAGAGGCTTTGAGAAGCCAGTGG
GCCTTGGCCTCAGCCCTGCCGGCAGAGGGTCCCCACCATGCAGCTGAAGTGCCAGGGTGC
TTGTGAAGTCTAAGCCCTTGTCTGGCATTTGTCAGGAATATAGG
gtgaggcctctgggaccgagcggggcggggcggggcggggcggggcggggcgggaccaac
agcgcacacttaagcggcccgggcgggtaccgccgtcccgccatggctctgaggcgcgcc
ctgcccgcgctgcgcccctgcattccccgcttcgtcccgctgtccacggcgccggcctcc
EXON 2  313 bp
tgagaagccagtgggccttggcctcagccctgccggcagagggtccccaccatgcagctg
aagtgccagggtgcttgtgaagtctaagcccttgtctggcatttgtcaggaatatagggt
gaggcctctgggaccgagcggggcggggcggggcggggcggggcggggcgggaccaacag
CGCACACTTAAGCGGCCCGGGCGGGTACCGCCGTCCCGCCATGGCTCTGAGGCGCGCCCT
GCCCGCGCTGCGCCCCTGCATTCCCCGCTTCGTCCCGCTGTCCACGGCGCCGGCCTCCCG
CGAGCAGCCCGCAGCGGGCCCAGCGGCCGTGCCAGGAGGTGGGTCGGCCACGGCAGTGCG
GCCGCCGGTGCCCGCCGTGGACTTCGGCAACGCGCAGGAGGCGTACCGCAGCCGGCGAAC
CTGGGAGCTGGCGCGGAGCCTGCTGGTGCTGCGCTTGTGCGCCTGGCCCGCGCTGCTGGC
GCGCCACGAGCAG
gtgcgcggggtgcaggcgggggcgcgggggcttctgccggtcccgggagcctttacggag
cttcctggcctgaaacgggtgcctcccaagcatctcctggagcaagggaagccaggaagg
gaggcgtttcctgcagtccctctcggacctcgcaaattttcctatttgtcgatgtctacc
EXON 3  209 bp
ggagaagcaagcggctttagctggtcttcaccatgaaactgaccctgaaagcccagtcgc
caagagaccatatcgaggccccatggctggggtgaagtgtggtcggggatgagcagcggt
gccttgctgggaaaggagagttcaggcagcccaggacagcggcttccctttgcctttcag
CTGCTGTATGTTTCCAGGAAACTTCTAGGACAGAGGCTATTCAACAAGCTCATGAAGATG
ACCTTCTATGGGCATTTTGTAGCCGGGGAGGACCAGGAGTCCATCCAGCCCCTGCTTCGG
CACTACAGGGCCTTCGGTGTCAGCGCCATCCTGGACTATGGAGTGGAGGAGGACCTGAGC
CCCGAGGAGGCAGAGCACAAGGAGATGGA
gtaaggcctgcccggtgtctgcgggctttctgatcatgaccctggagcacccagtgggag
caggtgggatgtatccagctgctgggcttcagcctcagctgggcagaggccaaggctagg
agagcttggtcagcccaactaccgatgaccctcctgggctctgcctggagttcttgcatt
EXON 4  35 bp
gcccctcccaggcccaagtgttccaccccaggctaggggtggggctggggctgcaccttg
gaatctaccctccaccggggttgtggtggggccctccgtgcagcctcagtgggaacgtgc
ctgtcacctgaggctcaggtggcgtgaccctgacctttgctctccccctccttcccacag
GTCCTGCACCTCAGCTGCGGAGAGGGATGGCAGTG
gtgagtgagaggctgccgcgcaggaacagactccctcccgactccgcacaccccttggtg
gctcaggagagtctaggctggggcacaagtgggccttggggtgacgtcggagcccgggct
cctccctatgtccagggcacctgccctgtcgctctgggctctgacatactcgcaagtgtc
EXON 5  150 bp
ggtgtagacaggagggtgggcttggggatgggaaccatggggcagtgcagtgccagggcc
aggctggcaaggccactatgcttggagccctcctgagggcaggggccctgggctattggt
gtgtgggtgctgggggtgggtgtttggagctgtgctcaggccgtgcattcgctattccag
GCACGAATAAGCGGGACAAGCAATACCAGGCCCACTGGGCCTTCGGGGACCGCAGGAATG
GTGTCATCAGTGCCCGCACCTACTTCTACGCCAATGAGGCCAAGTGCGACAGCCACATGG
AGACATTCTTGCGCTGCATCGAAGCCTCAG
gtggggccccctctttgctggctatacccctgccatgtcccagcctgagcggacccctgg
gctcatggaggtgccggtgggtgaacactaagctggggcaggagccagagggctgggttc
tgaccacacttgggtccctcactgttcagccccttcctgaggggccccactgcctcccag
EXON 6  65 bp
gagccccctcccatctccacagggcctctagagcgccatgtgcaaggacttcatgggcgg
ggtggggtggggtcaggagcctgctgtgggctggccaggccctggccctccctgtcgcac
cctgcgctgcctccatgcacctctcagggctgtcatggcttttcctgtggcttctgacag
GTAGAGTCAGCGATGACGGCTTCATAGCCATTAAGCTCACAGCACTGGGGAGACCCCAGT
TTCTG
gtaagtgctagaaccttccacctgcagagtctggtgctgtgcgagatctcagggcagctg
tgggcatccaccaaaaacacaggtgcccatgccttagaggcctgagctggccacaggggc
tgtgtgggggactggggtgggcaggggcgtgtgcagatggcattcaggcctgcgtttgca
EXON 7  117 bp
taagtgctagaaccttccacctgcagagtctggtgctgtgcgagatctcagggcagctgt
gggcatccaccaaaaacacaggtgcccatgccttagaggcctgagctggccacaggggct
gtgtgggggactggggtgggcaggggcgtgtgcagatggcattcaggcctgcgtttgcag
CTGCAGTTCTCAGAGGTGCTGGCCAAGTGGAGGTGCTTCTTTCACCAAATGGCTGTGGAG
CAAGGGCAGGCGGGCCTGGCTGCCATGGACACCAAGCTGGAGGTGGCGGTGCTGCAG
gtggggcagccttccccttccccactcctgtggcttgtgagggggtgggcaccgtggggt
cacacggggcatggtgggcagtggtcggaggtggttttgggaactcacccagggcatgtg
gctcactctgcagctgctggggttggcctggtggggaggaggaggtcagagggactctga
EXON 8  80 bp
tgggcgtgcatcagcagcggggtgggaatagacctgtctatgcagtagaaacaaaccaga
catggatcctgttcttactaacgatgtaataaagccagaaacagcaccagaggccaatgg
gtggggggaaggataaaatatgagtgaatggggctgatccaggccttctcacttctcaag
GAAAGTGTCGCAAAGTTGGGCATCGCATCCAGGGCTGAGATTGAGGACTGGTTCACGGCA
GAGACCCTGGGAGTGTCTGG
gtgagagcagcccccaggctgagaggacacgagcatcagccatggttccagccaagcccc
agtgacgtctcccagtcctggctgccctgcctgagagggtgggccctgggatgacagtgc
tgaaggaactgcttttcacacagcaggacttgatggcttcaggagtccctgaggctgggg
EXON 9  82 bp
cactggttttaaatttttaaacagaaaacaatatttatatttcctctgtcttttaaaact
gaacaccgaggtgggttttgtggtgggtggtgaacggacaggtttgggcctcgatccccc
acccgaccctagcacccacaggtgggggtgccccctctgctgatgcgcctcctccctcag
CACCATGGACCTGCTGGACTGGAGCAGCCTCATCGACAGCAGGACCAAGCTGTCCAAGCA
CTTGGTAGTCCCCAACGCACAG
gtaacacctccgctcctcagtgaggcccagctcagcagggcgctgcgctaagaagggaat
tcagcctgccacgtgtgtctcttgttgcctaccctgggaacttaacatgaccaaaatcac
tgcacactatggccccacagaccccctgtggtccagggggaagaagacaagcccactagt
EXON 10  93 bp
ctggctgcgttggaggttcaggggcactgtgctgcttgtccaggtggccctccctcccag
ccctgcacagacgggtgagagggttcctgtgggctgggaatactgagagaggtttagcct
gggcctcagggtggcactttcccgcccttgctgtggcctgaccgcgtgttgcacccccag
ACAGGACAGCTGGAGCCCCTGCTGTCCCGGTTCACTGAGGAGGAGGAGCTACAGATGACC
AGGATGCTACAGCGGATGGATGTCCTGGCCAAG
gtgagctgtcccgctcgggcagagggtacctgggactcgtggagaagagggcacctgcct
cacttgagcaacagttgctcccactctcccaccccctgcgcctctcagaaagccacagag
atgggcgtgcggctgatggtggatgccgagcagacctacttccagccggccatcagccgc
EXON 11  147 bp
ctgtcccggttcactgaggaggaggagctacagatgaccaggatgctacagcggatggat
gtcctggccaaggtgagctgtcccgctcgggcagagggtacctgggactcgtggagaaga
gggcacctgcctcacttgagcaacagttgctcccactctcccaccccctgcgcctctcag
AAAGCCACAGAGATGGGCGTGCGGCTGATGGTGGATGCCGAGCAGACCTACTTCCAGCCG
GCCATCAGCCGCCTGACGCTGGAGATGCAGCGGAAGTTCAATGTGGAGAAGCCGCTCATC
TTCAACACATACCAGTGCTACCTCAAG
gcaagcccccgctcagcccctccctgcctgccctggggcttggagaccccacaggagggg
ctcctctcatctgagctccctggcatttggctggttttacactcagcacccaccagggag
ctcatgggatggaggagggagtgggccgtgcccccaaggggttgttggggtcttctgcag
EXON 12  176 bp
ccttggggacagaggttggaggcccatcctcacccacacctgctccaggtgccctgagct
gcacctccccaggcagctgctgcccagccctggtgactgcacctgggcccaggaaggccc
catcctgctgtcacttgggcttgcccaggctccctgtgacttttggccctggccccacag
GATGCCTATGACAATGTGACCCTGGACGTGGAGCTGGCTCGCCGTGAGGGCTGGTGTTTT
GGGGCCAAGCTGGTGCGGGGCGCATACCTGGCCCAGGAGCGAGCCCGTGCGGCAGAGATC
GGCTATGAGGACCCCATCAACCCCACGTACGAGGCCACCAACGCCATGTACCACAG
gtgcgcagctctcccacccctctgtcttctcagggcagggcgccaagaaaccaggcctga
gggagaggcttggagactgaacttgtcagccacatgtgtccccaggtcagaactggtatt
tcctcagcttttatgtcatgtgttactttttcaaaagcattaaggttattcttttataaa
EXON 13  99 bp
atgaggtgctgggaggggcagatgctgctcctgttcctcctgatcctgtggatacccttg
gaaagagccagctcaatggatggatctgggtctgccctcggcctcctctctgtgcagctg
gtaatgagaggtgcaggcagccacaggcctggaactgggctcacatggcactctccacag
GTGCCTGGACTACGTGTTGGAGGAGCTGAAGCACAACGCCAAGGCCAAGGTGATGGTGGC
CTCCCACAATGAGGACACAGTGCGCTTTGCACTGCGCAG
gtaggtgtgccccaccctgcaccgaaaccccaacctgagccgttgtctcctccggctggg
gagaggtggcagcagcgcagagctcagggtgggcagagcgacctgctgggtggtcgggca
tttgtggggaaaggctggtgaaatgagctggagggtggcttcagtgggcaggcccaggcc
EXON 14  89 bp
ggggcagggccaggcagagcccataccccagccccaccttgcaggggatgaagtctggag
agtgcagatggggcacctgggatggcaggacaggctcagagctgggacaggagccctgta
tccctgcactggggacagtgtcctggaactggccctcagttcctggcttcacctgcacag
GATGGAGGAGCTGGGCCTGCATCCTGCTGACCACCGGGTGTACTTTGGACAGCTGCTAGG
CATGTGTGACCAGATCAGCTTCCCGCTGG
gtgagtggggccctccctggtgcgatggggtacggtgctgggcctgggcctcatggtgta
tctgcccccatgcaggccaggccggctaccccgtgtacaagtacgtgccctatggccccg
tgatggaggtgctgccctacttgtcccgccgtgccctggagaacagcagcctcatgaagg
EXON 15  581 bp
ggcttcacctgcacaggatggaggagctgggcctgcatcctgctgaccaccgggtgtact
ttggacagctgctaggcatgtgtgaccagatcagcttcccgctgggtgagtggggccctc
cctggtgcgatggggtacggtgctgggcctgggcctcatggtgtatctgcccccatgcag
GCCAGGCCGGCTACCCCGTGTACAAGTACGTGCCCTATGGCCCCGTGATGGAGGTGCTGC
CCTACTTGTCCCGCCGTGCCCTGGAGAACAGCAGCCTCATGAAGGGCACCCATCGGGAGC
GGCAGCTGCTGTGGCTGGAGCTCTTGAGGCGGCTCCGAACTGGCAACCTCTTCCATCGCC
CTGCCTAGCACCCGCCAGCACACCCTTAGCCTCCAGCACCCCCCGCCCCCGCCCAGGCCA
TCACCACAGCTGCAGCCAACCCCATCCTCACACAGATTCACCTTTTTTCACCCCACACTT
GCAGAGCTGCTGGAGGTGAGGTCAGGTGCCTCCCAGCCCTGCCCAGAGTATGGGCACTCA
GGTGTGGGCCGAACCTGATACCTGCCTGGGACAGCCACTGGAAACTTTTGGGAACTCTCC
TCGAATGTGTGGGCCCAAGGCCCCCACCTCTGTGACCCCCATGTCCTTGGACCTAGAGGA
TTGTCCACCTTCTGCCAAGGCCAGCCCACACAGCCCGAGCCCCTTGGGGAGCAGTGGCCG
GGCTGGGGAGGCCTGCCTGGTCAATAAACCACTGTTCCTGC
agctgagagccctttgccctcacacagggtcagctctgggcaacaaagagggagtggctc
agacagggtcagagaagtctcatcccagactctggcttccagcatcatctgttcctgggg
gccaggccctgcgcagacctggccacccagggtgctggacacccccaaccctgactccac