Gene POLR2F Variant 1
DNA : 14.09 KbNT_011520
mRNA : 545 bp NM_021974
CDS : 384 bp NP_068809
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  97 bp
caccggtgccacgcagaaatactgcgcgatctgggctgctggagctggcagctagcgcct
ctcgctactatagaaacgcgcacacaccagtcagcgcatgcgcactttccccgctctgtc
ctgcctcccggaagtgatttcctctgggttacggcgcaggcgcaagataagctaggagcc
GCGCGAGTCGTAGTGTCGCTGTTTGCGGGTCTCCGCGCGGGACCGGGGCGCAGCGGGGTC
GCTGAGGCGAGGGTGTCATGTCAGACAACGAGGACAA
gtgagtgcgggagcggagtggcctttgcggcaaccttggaaggggcggatgaggcaaggc
ttgggtcggctgaggagcctggcgtctaggggcaatgtctgaggggactggggtcctgag
ggggccggcggagccgaggaagggaagggcgggcgacccaggagcacagccccggctgga
EXON 2  70 bp
ttttagtagagatggggttttgccttgttggccaggctggtcttgaattcctggcctcaa
gtgatccgcccacttcaatctccgaaagtaccaggattacaagtgtgatccaccgtgcct
ggcccctctttgattcttttaagtgatgctctaagtaactgatctcttcttcctgtacag
TTTTGATGGCGACGACTTTGATGATGTGGAGGAGGATGAAGGGCTAGATGACTTGGAGAA
TGCCGAAGAG
gtcagtattcagcctcaggctcccacctctgcagcccaagctgccaaatcgtctgacagg
tgatgattagctgaatgtgtctgccttctatttgtggtcaaggcccctgccataagcatt
cccagttagagtgagctgtgttccagtcttgcatagcagaacagccctgcagggtgggcc
EXON 3  131 bp
tgcctcataaggttattgtaaggattacatgagttgttaggaagcagttatgtggtcccc
tggcatgcagtaagcattaacggtggctgtagcgagaattgtgattgttgtcattatcac
tctccctgtaacccaaaagtgccacctgagtctttccctcttttttgtcttggtgtccag
GAAGGCCAGGAGAATGTCGAGATCCTCCCCTCTGGGGAGCGACCGCAGGCCAACCAGAAG
CGAATCACCACACCATACATGACCAAGTACGAGCGAGCCCGCGTGCTGGGCACCCGAGCG
CTCCAGATTGC
gtgagtgattgccccttcactgtcttctccatctgtcaggccacagtaagctcttgtacc
gctgatctttcccagcctggcacctgaaaacagactctctgctctcacattccaaaagtg
gtgccgtccctgcgtaccaggcattgagctagtcccctgccctcagggagcttgtgatct
EXON 4  72 bp
gataggcctctgccagggaagatctctggcagtgcccctacacaccactccctactgtgc
ctgcctacctagaagatgacgtttctaggtggggaccaggatgccgttccaccctcactg
cctgttgggcccttctccctgggtttgtagtctccctaacacctgtccctatccctacag
GATGTGTGCCCCTGTGATGGTGGAGCTGGAGGGGGAGACAGATCCTCTGCTCATTGCCAT
GAAGGAACTCAA
gtaagtcactcaaatcatggttcacttctccaaatctctgggaggcatctgttgggctct
ctgttgcaccctttgctcccacttgcctggctggagaagttgatgcttattcctacagat
ccttaggaacagctcaccaggaagtaggaggaagagagaagaggaggcagggaaagtggg
EXON 5  175 bp
cttgtctgatataaaaactttctttttcttgtaattgctttcttacaaagtacactcatc
agccccaagaggctgctcctaagacttctctttgcttgtgttttgcacacaatctgttcc
ttctgcggcagagctggggtcaccagccctcatgtacttgtgacttctcccctgccacag
GGCCCGAAAGATCCCCATCATCATTCGCCGTTACCTGCCAGATGGGAGCTATGAAGACTG
GGGGGTGGACGAGCTCATCATCACCGACTGAGCTGGAGTCATCTTCCTGCCCTTGCCCCA
TGCCCAATTTTCATTCTCACTTTATATGTGTAAATAATAAAATATTCAACTTTCC
aacccccttcccctctgcttatctgcaatgtcaccacctgttgcttccccgttaccgcca
tgctgcgtggagcatgcacctattccagtggccctgtgactgtcagctccttaagaagca
ccaggggcccttagcccctttggatcccccacatccttccctccatctccctgttcccca