Gene KREMEN1 Variant 2
DNA : 69.38 KbNT_011520
mRNA : 1821 bp NM_153379
CDS : 1422 bp NP_700358
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  104 bp
ctccgcggatccgggcgggccccaggctgcaggggcggtggcggcgctgagctgggcggg
ccggggcggggcggccgggcggccggggcggggctacactcgggccccgcgtcctgctcc
catggccgcccccggctccccgcgctgccccctttaccccgggccgcgccccggggcccc
GCACTGACGGCCCATGGCGCCGCCAGCCGCCCGCCTCGCCCTGCTCTCCGCCGCGGCGCT
CACGCTGGCGGCCCGGCCCGCGCCTAGCCCCGGCCTCGGCCCCG
gacccggtgagtgtgagcgaccccccgccgcccgccctgagcggagcccactcgaggggc
gacaagggccggccggcctgagagccccctccctcccgcttcaggaccttccgggcccct
tcccctcgcccctaggcgacgcccctcaggccgggatggtcccttcctgggacccgggct
EXON 2  163 bp
tgagggtaccttgtttcagatttattcagccccagaagtgttaactgcactgtgtccagg
atctagcaagacactatccatttccagcttggtccaaacaaaacaaaacatcaaccaaag
agggaggaaaccatgaatgttgccagaaaattagtttgctctgtcttttttttcttctag
AGTGTTTCACAGCCAATGGTGCGGATTATAGGGGAACACAGAACTGGACAGCACTACAAG
GCGGGAAGCCATGTCTGTTTTGGAACGAGACTTTCCAGCATCCATACAACACTCTGAAAT
ACCCCAACGGGGAGGGGGGCCTGGGTGAGCACAACTATTGCAG
gtaagatggggccactcagtactttaaaaagatagatatatatctagtctcttcttccaa
cccctttcatcccagctcacaactaggggaagtcttttgaccaactcaagagacttatct
tgtcagttttaaaaatatttctttcacaccttacacacacacacacacacacacacacac
EXON 3  92 bp
atgtttgttcttgtaatattaccattttttcccttttgatgagagatggcactgagatac
agaccaactattagaaataatacagaagctaaagcatttccttttctgtaaaactgaaaa
gcaatgaaccagttgaattaaaacatcagaagtcatcaattgtgtccttttccccaacag
AAATCCAGATGGAGACGTGAGCCCCTGGTGCTATGTGGCAGAGCACGAGGATGGTGTCTA
CTGGAAGTACTGTGAGATACCTGCTTGCCAGA
gtaagactgtaatacccaatgtgatggtttacaggactgtgaacactaagagtgcgtaga
gggaggcccctgccagaggtcaggtagttaggctggtggatttcatggagcatgtgaaag
gagaagccatcctgggcgaggattttcacttctcttgttgaggcttttcaggaataggaa
EXON 4  125 bp
catggtttttagcagaggacactaaagcttccattttcaaagctggttgcttgttgttta
tttgtacctcaggagtggaaatactggctgagatgaaagtacctggcacaaatcgctttt
ccttcttggtgtttcacagccagatgttgcgaaattcttttgtttttcttttttctttag
TGCCTGGAAACCTTGGCTGCTACAAGGATCATGGAAACCCACCTCCTCTAACTGGCACCA
GTAAAACGTCCAACAAACTCACCATACAAACTTGCATCAGTTTTTGTCGGAGTCAGAGGT
TCAAG
gtgatgactctgtggctgtgtaactatagaaaaatataaagatgtaaatgcattttgctg
agataacttaaaaataagtgctaagtaaaataagccagacacaaaaggccacatattgta
tgattccacttacatgaattgtctagaataggcaaatccatagggatagaaagcaggtta
EXON 5  154 bp
gtacttattgttcagcttgaaattaagtgttgcaagagtggaagaagggggaggtcccag
gggaagggaccctgggaagttgaggctgattgcttgctggaagcccaccctgccaggctc
cttcaggccatctgacatccctgatgatgcttaccgtgtgctgcttctctgttgtggcag
TTTGCTGGGATGGAGTCAGGCTATGCTTGCTTCTGTGGAAACAATCCTGATTACTGGAAG
TACGGGGAGGCAGCCAGTACCGAATGCAACAGCGTCTGCTTCGGGGATCACACCCAACCC
TGTGGTGGCGATGGCAGGATCATCCTCTTTGATA
gtgagtatgccctgtgcccatcactgcccaaggcacaggaacccttggaccagagcaaca
agcctgcccaccctccctcccttctatgtattcattcattcacttggcaatagacaatac
ttgtgactagaccctgggaatacagcacagtgcatgaagactcagcccctgccttctgga
EXON 6  333 bp
tctccacagtcatttttcgagagtctcagcgattcgttttgtgactgtcaggttttacag
atagaaacaatgtcctaaatgggatcctgctcgttaggaaggctttagtgccttggtgtt
ggaagcgcgcctgtggcaaaggcccagactgagggcgtggtgtctttttctctcctacag
CTCTCGTGGGCGCCTGCGGTGGGAACTACTCAGCCATGTCTTCTGTGGTCTATTCCCCTG
ACTTCCCCGACACCTATGCCACGGGGAGGGTCTGCTACTGGACCATCCGGGTTCCGGGGG
CCTCCCACATCCACTTCAGCTTCCCCCTATTTGACATCAGGGACTCGGCGGACATGGTGG
AGCTTCTGGATGGCTACACCCACCGTGTCCTAGCCCGCTTCCACGGGAGGAGCCGCCCAC
CTCTGTCCTTCAACGTCTCTCTGGACTTCGTCATCTTGTATTTCTTCTCTGATCGCATCA
ATCAGGCCCAGGGATTTGCTGTTTTATACCAAG
gtaagacatctttgcctccttgggggttcttcagggcccacgtgccttgggcttctcttc
ttcacccttgtgacttgggcagttcttgcggggcagattgggcctcaggaactactgact
caacttgcagatcaccccgaggctgtggctccttccctacccccatttcataactcattt
EXON 7  210 bp
ttctaaagggtgacagcctgacaggttctgttttggggctggtgggacccacctatggaa
ggaattgcacccagaattgaatcagagaagaactcttcttcataactcgtgctctcctcc
cgcacaactctttgttgtctccatagccctgtccccagttaattgctttttctcttccag
CCGTCAAGGAAGAACTGCCACAGGAGAGGCCCGCTGTCAACCAGACGGTGGCCGAGGTGA
TCACGGAGCAGGCCAACCTCAGTGTCAGCGCTGCCCGGTCCTCCAAAGTCCTCTATGTCA
TCACCACCAGCCCCAGCCACCCACCTCAGACTGTCCCAGGTAGCAATTCCTGGGCGCCAC
CCATGGGGGCTGGAAGCCACAGAGTTGAAG
gtagcgctcttgacagttataaagacaaaagcacttgggtgtttcttattcagaggcagg
ttgggatactggctctgtgacctatagtctgtcctggcttttgagggaaattttcttatt
agcttggttccttagtcctgagggaaaagtgctcacctccaaaaattaggcaagcgtgcc
EXON 8  85 bp
cctggggccccatgcttagcctgggtcagctgctcctgaggctaggtttgctagctgccc
tcccacaccggcctgcagggagcccctcagccagacttactcacttgggtattccagccg
acctcctttcgaaaaccaaccataaacaagtctggtaagctctgtcttttgcacttgcag
GATGGACAGTCTATGGTCTGGCAACTCTCCTCATCCTCACAGTCACAGCCATTGTAGCAA
AGATACTTCTGCACGTCACATTCAA
gtgagtacaagagggagctgcccaattccaggaaagggaaggctcagagttcattttcta
tgatgcttcatttgtctggttacaactgtagaataagcacatgattccaaagccctcagt
cctagggaacggaaggcagcagacattcccccttctttgtagagtgaaatgtacaactgg
EXON 9  555 bp
gcccctgctgcccacaggccacatttcagttgcacgctagtccttcagatctttagaggt
ggctgtgaggtccttcccaagaccttgccccaccccatttcatagatacagtatctcgtg
agatggtaggttgtttgcgttgttctaatctattggaaaaaatatttatctgcttgacag
ATCCCATCGTGTTCCTGCTTCAGGGGACCTTAGGGATTGTCATCAACCAGGGACTTCGGG
GGAAATCTGGAGCATTTTTTACAAGCCTTCCACTTCAATTTCCATCTTTAAGAAGAAACT
CAAGGGTCAGAGTCAACAAGATGACCGCAATCCCCTTGTGAGTGACTAAAAACCCCACTG
TGCCTAGGACTTGAGGTCCCTCTTTGAGCTCAAGGCTGCCGTGGTCAACCTCTCCTGTGG
TTCTTCTCTGACAGACTCTTCCCCTCCTCTCCCTCTGCCTCGGCCTCTTCGGGGAAACCC
TCCTCCTACAGACTAGGAAGAGGCACCCTGCTGCCAGGGCAGGCAGAGCCTGGATTCCTC
CTGCTTCATCGATTGCACTTAGGAGAGAGACTCAAAGCCCTGGGGCCCGGCCCTCTCTGC
ATCTCTCTCTGATCTAGCTAGCAGTGGGGGTGTCAGGACAGTGAGGCTGAGATGACAGAG
GTGGTCATGGCTGGCACAGGGCTCAGGTACATTCTAGATGGCTGTCAGGTGGTGGGTAGC
TTTAGTTACATTGAA
tttttcttgcttctctatttttgtccacacacaaatcagtttctcctgatctttatgtct
tggaacagggccagacagggagaactctcaggtactcttgggagttggtcccatacaagt
gcggactcctggacattagcgaggtgtaaagagggcagtgtctgtgctgccccggcagct