Gene GNB1L Variant 1
DNA : 66.52 KbNT_011519
mRNA : 1513 bp NM_053004
CDS : 984 bp NP_443730
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  120 bp
acgcggccccacctgatcccgtggcacttggcgcggcgtgggaatgggcgcgctctccca
tcacccaccgcgcggcactgccgcgccagcagggaccgggagagcctgcgaggtagcggc
cacacggcatacagcgcaggcgcggcctggatgggaggagcgcgtggagcgtgccgggag
CATGCGCCGGGTCGTACACGGCGGCCGCGCGCACGCTGGGGGCGTGGCTGCGCGATGTAA
TCGGTCTCTGGACGCTGCGCGGCGCTCCTAGGAGCAGGCGTTCCCGACTCCGGCAAGAGG

gtcagtgtggaggcgggagcccgggcggccggcttgaactccgtgcacgcgggcctggag
ctgcgcccctgcgtcttttcccgacttctgatccgcagaggggcactcggagccccagcc
tgggtcgcagtgccttcggtctgcgggcctcagtttctcggtccgcgccgggggtttgtg
EXON 2  97 bp
gggcactcggagccccagcctgggtcgcagtgccttcggtctgcgggcctcagtttctcg
gtccgcgccgggggtttgtgggggcacctggagacatttgggccgttctcgcagtctcgg
gaagccgcgcccgctccttgcctggcctcacggcggccgatctcgttctccactttctag
GTGGCGCCTGGACTCTCGCCCTCAGAGGGAGGCCCGTCCCACGGTCTGTGGCTACGGATC
CCAGGACCCTCTTCGCGGGCGATTCGCGTAGCCTCAG
gtgggtgggcttcttgttgccgtgggccttgtgagctcgtatttcctgcatggcggttgc
tggggggcgggcggtgcagtcgtctgcactcagcttgctttaaggctttgggcaggtttt
gttcttggggctcctgggtctccccagagcagagaacggctccagcgttccaggtgctgc
EXON 3  148 bp
ctctgtagccacaggccgttcatcagtgtctggggagcagtggcacctctctcccaggag
gggcacagggccagagacaatgagcaggggcaacatctcaagcacccctgtgcctgagca
gccttcctagagggtgagaatagggacgcagtcactcacacgccctcccttggtgcccag
GTAACTGCATCCTGCCCAGCATGACGGCCCCCTGCCCGCCGCCACCTCCAGACCCCCAGT
TTGTCCTCCGAGGCACCCAGTCACCGGTGCATGCGCTGCACTTCTGCGAAGGAGCCCAGG
CTCAGGGGCGCCCGCTCCTCTTCTCAGG
gtgagtagctgtggccccagccccaggccacccagggccaagtcaggaggtcgtgagcta
gcaaggagcccagcgcttgtttgagggtgctggccaaggggcatggactgctcgccaccc
aggcttgctgagctttcagcacccaccagcagacacactgtcccttgggggaggcaggga
EXON 4  126 bp
tctggaagaggagcaaggagtgctttgccagtttggcccttagttcatatttagagctgt
tggcttttcagctcaaccagcctagatgcccgcatcccacaatgtggcctccaggctggc
cccagagcattcagcacacccttctgccccctgacaccctgctcggcttgtctgaaacag
GTCTCAGAGTGGCCTGGTACACATCTGGAGCCTGCAGACGCGGAGAGCGGTTACCACCCT
GGATGGCCACGGCGGCCAGTGTGTGACCTGGCTGCAGACGCTGCCCCAGGGGCGCCAGCT
CCTCAG
gtgggtctccaaggtgcaggagccaggtatggccttcgggggagtcaggaactctctgat
ggaggctctggtgtcccccactgaggggcagaatggggtgggggaaccagaaggggccag
caaagggtccgcagcaagggcagggtgtgcaggtccagccccttgtcacagggaggcagg
EXON 5  163 bp
tcaagtgtcaatgccagagcggtgaggcccttcctcagctgaggctcccgacctgcgatg
atccaagctcacggcacccactctctggaaacatggccttgccttccttccgctgcaggg
gccatgggagctgacacttgtcaaggggagtctcaggcctgtctcctctttgtctggcag
TCAGGGCCGGGACCTGAAGCTGTGCCTGTGGGACCTCGCGGAGGGCAGGAGCGCTGTCGT
GGACTCCGTGTGCTTGGAGAGTGTGGGCTTCTGCCGGAGCAGCATCCTGGCCGGGGGCCA
GCCACGCTGGACGCTTGCCGTGCCAGGGAGGGGCAGCGACGAG
gtgagagccagcctgcctgaggccccatgttctccaaacagttgtgctcatcctctgcat
ttgattaggaggcgcctgcgcctacccacaggactccatggagccgcccacctgccggca
gcttcagcagccggggctgatgcacagccggctaggcctgggcctgtccccttggggtgg
EXON 6  99 bp
gagagcgttttgcaagggcccatgcagcctaattaggagcctgggctcccaggtgcccac
ggggaggggagcagacagaaactcacagcagcccgggctaatcgccttaagagtctcttg
tttgtatagcgcagactcgacttggcgacggcccaaatcaacttgttttcttactgtcag
GTTCAGATTCTGGAGATGCCCTCCAAGACGTCAGTGTGCGCCCTGAAGCCGAAGGCAGAT
GCCAAGCTGGGCATGCCCATGTGCCTGCGGCTGTGGCAG
gtaaggccccgcgtgcaccagccacgccctgccggccacacccacggccatgagtcatgc
tccattcaggatctgatttatcgtcgagccactcaggcaacaccccacccccctgccgca
gggaacctgtgcagctgcctcagtgtccccacggccctctgcttcctgctgctgcaaggg
EXON 7  216 bp
caggggctgtgtgggagggcactggcggtgcagagcttctgagctgtggcagccacgtgg
aagacatgggaaacagccccagccagcaggaggggcaggaatttccagagccccttctcc
cccgaaactcactggagtcagggtccttccaggagctgactgctctgctgttccccgcag
GCCGACTGCAGCTCCCGCCCACTCCTTCTGGCCGGCTATGAGGATGGATCGGTGGTCCTG
TGGGACGTCTCTGAGCAGAAGGTGTGCAGCCGCATCGCCTGCCATGAGGAGCCCGTCATG
GACCTTGACTTTGACTCCCAGAAGGCCAGGGGCATCTCAGGCTCCGCGGGGAAGGCGCTG
GCTGTCTGGAGCCTGGACTGGCAGCAGGCCCTGCAG
gtcagtgcgccaggccccgggtctcatttatcctgctctgcactaacagtctgataggct
gaaacaatatttaggcatgaagaggagttgttgcagatccctggctaattaatcacttgg
aggcgggtgcaggggggctgtccatggctggcgcaggaagaagggggcgtgggcgctggc
EXON 8  544 bp
tggagtcccccatcgtggccttaggaagagtgggaggtcagctgggtaggagcgtgtggc
cctcacatcccgggcctgtgggcctgcgtctctcctggttccagctgcaggtggggcacc
aggggcagcactgccttgtgggcttaaggagtggcctaacacctctcccaactctcacag
GTGCGTGGGACTCATGAACTCACCAATCCCGGGATCGCCGAGGTCACGATCCGGCCAGAT
CGCAAGATCCTGGCCACCGCAGGCTGGGACCACCGCATCCGCGTGTTCCACTGGCGGACG
ATGCAGCCACTGGCCGTGCTGGCCTTCCACAGCGCCGCTGTCCAGTGCGTGGCCTTCACC
GCCGATGGCTTGCTGGCCGCGGGCTCCAAGGATCAGCGGATCAGCCTCTGGTCACTCTAC
CCACGCGCATGACTCACCCACTCCCTTCCCGGGAGACGAGGAGGGCGGGCAGGGAGGTGG
GCATCAGGCCCCAGCCTTGGCCTGAAACCTCAAGGGCCTCTGAGGACCAGCAAGTCATGG
CCCAAGGACCATGGAGTCCCCGCTGTCTTCATGAGGTTGGTATTTCCTTTTGTGGAGTGC
CTCATCACAGGACGGTGACTCTGGGGGCCAGCCAGAGCCCTGGCCGTCCGAGGCCTGCAG
GAGACGTTGGCTTGGGCCTGCTGTGTTGCCAGCTGAGGGTATTTTATAATAAATTTCCAT
TGCC
aagttgcaggcttgaggtgggagctccctgaggaggccctggtcccccacttagcatcag
tgccctcagacccccaccaggcaggatgctcagccccaccctcacacctgctgttgaatg
ggccaccccgagtgtgggtttcctgggccaggcctcaggagatgataggccccaaccata