Gene EWSR1 Variant 1
DNA : 31.88 KbNT_011520
mRNA : 1807 bp NM_013986
CDS : 1752 bp NP_053733
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  68 bp
ccttagatgctattttggcccgagtgtcacgtcgggcgctctttagagaggactgggaca
agagttgcggacgcgaagaacgagtaagcggtggttcatccctcctgaccccacccccgt
ggcctggcccgatggtcgcgcccggggttgcgagatttgcgcctgcgcagtgcggcgcct
AGAGGGAAAGCGAGAGGGAGACGGACGTTGAGAGAACGAGGAGGAAGGAGAGAAAATGGC
GTCCACGG
gtgagtatggtggaactgcggtcgcgccggcggtagccggaacgcccaaactgggggtcg
ttcgtctctgggcttggctgggaagactgagtggagttgccgagagggggttgaggcacc
cgccgcggcccgacgagctcggggatccgcattcctctcccctcccccaaccgggcgggc
EXON 2  37 bp
tggtttagacttttttttctgttagatgttgagaggtaagggggactcatttggacctgt
gttggcaggtctccctacagtttaaagaattcttcctgccacgtgaattctttccccctt
ttttctcttctccttgtttctgctaactttacactatttttcctccttgttttcctctag
ATTACAGTACCTATAGCCAAGCTGCAGCGCAGCAGGG
gtaagtcagtcttttataaccgtattttgtgtgtgattaatattttttgaatatggagcc
ttctataattgtagaggtggtatttgaatgttctctattcaagttattgcatttaattct
tttgcagctacagtgcttacaccgcccagcccactcaaggatatgcacagaccacccagg
EXON 3  52 bp
ccttgttttcctctagattacagtacctatagccaagctgcagcgcagcaggggtaagtc
agtcttttataaccgtattttgtgtgtgattaatattttttgaatatggagccttctata
attgtagaggtggtatttgaatgttctctattcaagttattgcatttaattcttttgcag
CTACAGTGCTTACACCGCCCAGCCCACTCAAGGATATGCACAGACCACCCAG
gtaatctttaaaataattacatgtagctgcacctccaagtaaaatcagtatattatccag
ttatctttcagttatccagtaaaacaaatgagtaatgtgtttggaatagtaaaataccca
ggcattttaaactttcacagtgggagtgcgaaggactccattgtgccatcataaatgaaa
EXON 4  124 bp
agataagggataacattcatgatactgtgattatttgtcttgttttgttgtttttgtttt
gtttttttaatcttctagaaaggaatgtttttgattttggttctccaatttagtccattt
tattgctaaaatacaaaagttcatgtatgaagttcttgcattcgtttttttttggagcag
GCATATGGGCAACAAAGCTATGGAACCTATGGACAGCCCACTGATGTCAGCTATACCCAG
GCTCAGACCACTGCAACCTATGGGCAGACCGCCTATGCAACTTCTTATGGACAGCCTCCC
ACTG
gtaaggcctgccttggagagatttttgggtcgttctggctagggcattggctaagaagct
tattagtcatgctttcggatgtatattctggtccataccttggcatctggggaatccttt
attcttaggaagaggtattttttctctttcttccctactcttatagtcttgagagatctc
EXON 5  187 bp
attcagagaacttaggctttaaataccagtttgttgctactcttgcggaagggggaatat
ttaaagggattcaatatcctgatggtttaaagtaagtggtttacaaattgttctgataat
gagtgtctaggcagatctctgaggggacctgaaatctgatgcagctctcctttgttctag
GTTATACTACTCCAACTGCCCCCCAGGCATACAGCCAGCCTGTCCAGGGGTATGGCACTG
GTGCTTATGATACCACCACTGCTACAGTCACCACCACCCAGGCCTCCTATGCAGCTCAGT
CTGCATATGGCACTCAGCCTGCTTATCCAGCCTATGGGCAGCAGCCAGCAGCCACTGCAC
CTACAAG
gtaaggccatggtgtccttaatgcgtcagtcttatgttggagggaaagaaagcaactgtg
tacacttaaaataatctgtggtttagttccttattagtggttgctttcatatactctcag
atgttcactgttagtaactgatgtgctagaacataccacagaaatattctgcatttaaca
EXON 6  168 bp
gacactgagtttgatgtagtttactttaggattgtatttattattgtatttatttccagg
cttaatcataacattgcttattgctcgtagctttgtagcattcttacccaggagttttgt
ggttgaccaaccacacaaaaaaagtcactttttaattttatttattatttctcctcttag
ACCGCAGGATGGAAACAAGCCCACTGAGACTAGTCAACCTCAATCTAGCACAGGGGGTTA
CAACCAGCCCAGCCTAGGATATGGACAGAGTAACTACAGTTATCCCCAGGTACCTGGGAG
CTACCCCATGCAGCCAGTCACTGCACCTCCATCCTACCCTCCTACCAG
gtcagtctactttttgtggcaaaacaaaaacagtgacaaaacagtttttttcaggttgtt
gaccagcttgctttgacttcttcagctaaggtatgttatctgactgtcgcagtgataagt
catctgaccatacttggttacattaaagcctgagatctagggtcccatagtgttgcctgg
EXON 7  212 bp
ttattctgaacacaaaagtatttgctgagttgaaattcaaattgttgatgtgtagaaagt
aactactgttttatggatgtctgtgtcacatggtgtgaatgtctcttttattcaggggat
ttgaaataacaagcctctttctaaaaaagcttttttttttttctcttctctctctttcag
CTATTCCTCTACACAGCCGACTAGTTATGATCAGAGCAGTTACTCTCAGCAGAACACCTA
TGGGCAACCGAGCAGCTATGGACAGCAGAGTAGCTATGGTCAACAAAGCAGCTATGGGCA
GCAGCCTCCCACTAGTTACCCACCCCAAACTGGATCCTACAGCCAAGCTCCAAGTCAATA
TAGCCAACAGAGCAGCAGCTACGGGCAGCAGA
gtgagttgctaagagagaaaaccaaataagaatgaatgtgtttagagtttttttgtgggg
ttgattttttttgttggtttgtttttcttttgagatggagtttcactcttggggctgagg
ctggagtacagtggtgccatctcagctcactgcagcctccgcctcctggttcaagcaatt
EXON 8  33 bp
cctagcaaacctttcacaaatgttaaagagacactgctccattttagcagtgcgggtcat
tttgagtttaatgaatccccatcaaatggtggtatagtagatagctatgtgtgtttgtaa
ggtttgtagcttgcaagacgtgcactaataatattttatatgatctttcctggttggcag
GACCCATGGATGAAGGACCAGATCTTGATCTAG
gtaattttgaattctagttgtgcttcatatcgtgctttgtaaattaatggtacagaggta
aatgcatgcgtagagttcagcagccttatagaccagtgtgatattcttgctgtcaaggac
agtttgggaaatcctatgtgagcatctactcataattgccttaagtgaagtaaaccaaaa
EXON 9  119 bp
tgagcatctactcataattgccttaagtgaagtaaaccaaaagtttgatagcattcttct
tagtatgcttggtagttttcttagatttatgatgaatatccttgggcagtagtgatcagg
tagttaagaaacccctatagatacatgataataattctcctgtcttgttgtctctgaaag
GCCCACCTGTAGATCCAGATGAAGACTCTGACAACAGTGCAATTTATGTACAAGGATTAA
ATGACAGTGTGACTCTAGATGATCTGGCAGACTTCTTTAAGCAGTGTGGGGTTGTTAAG
gtcagtaaaagcataaccaggtcatctggcagaactttaaaccacagagcattttaaaga
gattgaattgatgttgagagttgttttctaaggttgcctttgcctgacttctttctaggt
atcttatggtttgttcctttttaaaaaagattagcctttttttttttttttttttgagac
EXON 10  130 bp
taaagcagggatagaggagaaaataacttagaattctgaaaaacttaaaagcggagaaac
ggtgacatttagtgacttactacatgtgagaaattggtacttttcctggattttgcctgg
acttttttctcccaaattagtatattctagtcatgcctaactatgctattctttgtctag
ATGAACAAGAGAACTGGGCAACCCATGATCCACATCTACCTGGACAAGGAAACAGGAAAG
CCCAAAGGCGATGCCACAGTGTCCTATGAAGACCCACCCACTGCCAAGGCTGCCGTGGAA
TGGTTTGATG
gtgagatgtactcactggcattcttaatctccctggctatagaatatggcatgagggaga
aacttgtgaaccataggagcaagaagaccttccatctcttcctgggggaggtagatggcc
ggtctccctgcagtagtagtagcacccagccattgaccctggatttggagatccctttat
EXON 11  123 bp
cccgggcaacagagtgagactcccatctcaaaaaaagcctttttctggccttgtcattaa
agatcttagagaagattacaggcagacctaatgcatctgggagtggtcatttgatgatga
tgtggagttggtgaacagggagtacaggggagtaattgatgttctgttgtcttgttccag
GGAAAGATTTTCAAGGGAGCAAACTTAAAGTCTCCCTTGCTCGGAAGAAGCCTCCAATGA
ACAGTATGCGGGGTGGTCTGCCACCCCGTGAGGGCAGAGGCATGCCACCACCACTCCGTG
GAG
gtactttttctgagctcctatgttgcattaaaaggttttcagtacacttcatacccttga
gaaacttgattattagagtgaagaaatataaaattgtgtgtagagtcaatactagactat
cgagagctaacaatgaatgtttgttgggaataaaaggaagagaagaacatgggaggctgg
EXON 12  163 bp
cgtggaacacgctcctcacagggaagggggctgatggcctgagccacacggaaacacggg
acaggtgatggggaaatgacagcagtagtatctgtgggtttacttagtgatttttatttc
ctatagcaaatttggtgctacagagaaatgatttgctgtttcttgttgttcttgttgtag
GTCCAGGAGGCCCAGGAGGTCCTGGGGGACCCATGGGTCGCATGGGAGGCCGTGGAGGAG
ATAGAGGAGGCTTCCCTCCAAGAGGACCCCGGGGTTCCCGAGGGAACCCCTCTGGAGGAG
GAAACGTCCAGCACCGAGCTGGAGACTGGCAGTGTCCCAATCC
gtatgtacttgtcttggcaaattgataccctacgagtgaagccacccttccctcacccca
tccccactctagagtggattgctctgtctagaggaacagaatgatgaccctgatggctgg
ttagggacactagtcagccattcactggacgcttcagagccttctgaagattgatttgac
EXON 13  98 bp
gccttctgaagattgatttgacctgtcctgtgggtgcaatgctgcctgaggctgtgccct
aaagcatgggtgtacatagatcctcttgatagtgagtgtgtacctgttcacacaccacct
ttccttgtttatcttccttagttcaattggtgatttctgctgtgatgtaattgtatgcag
GGGTTGTGGAAACCAGAACTTCGCCTGGAGAACAGAGTGCAACCAGTGTAAGGCCCCAAA
GCCTGAAGGCTTCCTCCCGCCACCCTTTCCGCCCCCGG
gtaggtgcaggtttcatgagtgtcccctcagcttcctggtgctaaacctcttttcttatt
tgtgggcttggtaaactgcagttgccctctgcttaacaactttgagttgtcgtgtcctca
tttctaaattgtcagcccgatgccgagattgagtgaagtgtctggtttgttctgctgtga
EXON 14  253 bp
tctgcttaacaactttgagttgtcgtgtcctcatttctaaattgtcagcccgatgccgag
attgagtgaagtgtctggtttgttctgctgtgagagaaggaagcagagcagcttccacag
tgtccacagggcctctgcagccacccactgactgctttcgccctgctattctcaccttag
GTGGTGATCGTGGCAGAGGTGGCCCTGGTGGCATGCGGGGAGGAAGAGGTGGCCTCATGG
ATCGTGGTGGTCCCGGTGGAATGTTCAGAGGTGGCCGTGGTGGAGACAGAGGTGGCTTCC
GTGGTGGCCGGGGCATGGACCGAGGTGGCTTTGGTGGAGGAAGACGAGGTGGCCCTGGGG
GGCCCCCTGGACCTTTGATGGAACAGATGGGAGGAAGAAGAGGAGGACGTGGAGGACCTG
GAAAAATGGATAA
gtaagtgctggtgaaaagcagctgtgggccgccaggcacagtaagaggacagcccttccc
agcttggttggcgcaagtcctcatgtctctaggaagcttgtgatagtggttgggaggagc
caggaaggggcacctgggggctctggaagggcttcctcaccccttcccattctaaccgat
EXON 15  40 bp
aggaagcttgtgatagtggttgggaggagccaggaaggggcacctgggggctctggaagg
gcttcctcaccccttcccattctaaccgattgggaggagccaggaaggggcacctggggg
ctctggaagggcttcctcaccccttcccattctaaccgaagggccctctttaccttgcag
AGGCGAGCACCGTCAGGAGCGCAGAGATCGGCCCTACTAG
atgcagagaccccgcagagctgcattgactaccagatttattttttaaaccagaaaatgt
tttaaatttataattccatatttataatgttggccacaacattatgattattccttgtct
gtactttagtatttttcaccatttgtgaagaaacattaaaacaagttaaatggtagtgtg