Gene DGCR6L Variant 1
DNA : 5.81 KbNT_011519
mRNA : 1156 bp NM_033257
CDS : 663 bp NP_150282
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  207 bp
taatgtcgcgcggggagcaggcaggtgcgagcctgggctgagcaaaaccctccttggagt
ctccgcagaggagcggggcgcgcctcctgaataagcaggcggcggggcgcggggcagggc
ggggcaggcggccaggccctctcgggactgtcgtaaaagggggcggagcgcgccgcgcgt
GGGACAATCGTAAAAGGGGCGGGACGCGCCGCGCTCGGGATGTCGTGAAGCTGGGGGAGC
TCGTCGCCGCCGCCGGCGGCTAGCGGGCGTCCGCGCCATGGAGCGCTACGCGGCCGCCTT
GGAGGAGGTGGCGGACGGTGCCCGGCAGCAGGAGCGACACTACCAGTTGCTGTCGGCGCT
ACAGAGCCTGGTGAAGGAGTTGCCCAG
gtacgcaggcggggcgggcggaggcctgcggaggcggcttcgtttcccgccggggctcac
cgcgcccccctacccgcagctctttccagcagcgcctgtcctacaccacgctcagcgacc
tggccctggcgcttctcgacggcaccgtgttcgaaatcgtgcaggggctactggagatcc
EXON 2  161 bp
tacgcggccgccttggaggaggtggcggacggtgcccggcagcaggagcgacactaccag
ttgctgtcggcgctacagagcctggtgaaggagttgcccaggtacgcaggcggggcgggc
ggaggcctgcggaggcggcttcgtttcccgccggggctcaccgcgcccccctacccgcag
CTCTTTCCAGCAGCGCCTGTCCTACACCACGCTCAGCGACCTGGCCCTGGCGCTTCTCGA
CGGCACCGTGTTCGAAATCGTGCAGGGGCTACTGGAGATCCAGCACCTCACCGAAAAGAG
CCTGTACAACCAGCGCCTGCGCCTACAGAACGAGCACCGAG
gtgcgcgggggcagcgggatgaggtgccgcctcctccgggtcggcgcctccgggcagctc
ttggtatctgtgcagatcagctccttccttggaagtgttcggaagaggtctctaagattg
acaaaatcaacgggcgcagagactgagacagcgcctttttggtgatcagtgggtccaacc
EXON 3  101 bp
caccagataagggcccggccctgggtgacagtggggtgggaggatggaggaggctggcat
cctccccactgcagacacccctttggcctggctgctctgctgggctggcaaggcaggtgc
ccatgggtgagggctgctgccgagtcccaccgcctgctgacgggctctcatccctcccag
TGCTCAGGCAGGCGCTGCGGCAGAAGCACCAGGAAGCCCAGCAGGCCTGCCGGCCCCACA
ACCTGCCTGTGGTTCAGGCGGCTCAGCAGCGAGAACTAGAG
gtactgggggcgcaggcagggtggccggcccagctctcctgtgggcaccacctggctctg
ctgactgggctgagctgaaggggtgtgggggctcaggcatgggtggctgtcctgggcctg
agtgggacactggaggcctagtgagtcccaccaggtggctcctctttgcggataccaagt
EXON 4  141 bp
cttcaggggttcacatggccgaggagaggcctgggtgtggtgaggatgcaccggtggtgt
cagagctgctgccactggggacggcagcaggagcatgtgtttgagctgccctcacctccc
cgccccctgatggcagagctgccctcacctctccccctccgcgccctggccccatggcag
GCCGTGGAACACCGGATCCGTGAGGAGCAGCGGGCGATGGACCAGAAGATCATCCTGGAG
CTGGACCGGAAGGTGGCTGACCAGCAGAGCACACTGGAGAAGGCGGGGGTGGCTGGCTTC
TACGTGACCACCAACCCACAG
gtcagtgcctgggcctgctctgccctagcccgagtgccccggggccccattccatctggg
gttttactgctggtccctggggagccaggctcagggtatgggggtgaagtggaaggattg
aggctctggaaaggatttctgtgccattcccagcacggaggccaggcccattccctacag
EXON 5  546 bp
ggctcagattccgagtggccctgttgggggcagaagctcagattccaccctgtcctggca
ggccatgaccaggcttcacaggatggtcgcccccgtgggctcactgcctggcacccttgg
gccgggatgaaaggggcctgggggtcactctggccttcatggggcccctctgtatcccag
GAGCTGATGCTGCAGATGAACCTGCTGGAACTCATCCGAAAGCTGCAGCAGAGGGGCTGC
CGGGCAGGGAATGCAGCCCTGGGACTGGGAGGTCCCTGGCAGTCGCCTGCTGCCCAGTGT
GACCAGAAAGGCAGCCCTGTCCCACCATAGCCACAGGCAGCAGAAGTCTGGGCAGAGTTC
ATCTTCTTGACCTTTGGCCACTGCCTTCCCAGCTGCCCGCAGGGGGTTCCCCCTGCTGAG
GAGAGACCAGGTGGACCCCAGCTGCCTGTCACCCTTCATCTGGGACTTGCTGTCAAACCC
TAGGATAGTCTCATAAAGGGGAGGCTGGGCCAGCCTGCTGCTGTCTGCTTCAGGACCAGG
CAGAGAGTGAGGCTGGGGGTTCTCACACCTTACTCCACCGGGCACATCCCAACCTGCACT
GGGGCCCACCCGAGCGCTTGTTCTGGTCTCAGCCGCTCCCTTGGCAGCTGCAGCCCCCAT
GCAGAAGAGGCTCCCAGGCCCAAGCTCTGTGTGACCCAGAGAAATAAAGATGCCTCAGTG
TGGCCC
aaatgtggcttgtgtgatagctgcaggttctgccataaccggggccctggtagggccccc
acctctgttgcagcagaggcctctacctgggggccccttcctgggctgtgtgcccagccc
accacccctccccctgcctggagactgggaccctccagcctttcctgccccagccctggt