Gene CRYBB3 Variant 1
DNA : 7.50 KbNT_011520
mRNA : 853 bp NM_004076
CDS : 636 bp NP_004067
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  52 bp
ccccaggaagtcatcagagacggtggctgaggagacaggcactgggggcctccgtggacc
cgctattggagtgaagtggcctggatggaattgggtggacagggtgctgcctcagcaggc
tgggatgtgctgggctgtcagaaagtgctcataaatagcatgccccttgcgaagacaggc
GAGTCTGCAGACGGCCGTGGCTCCTCTGTTCTTCCCGAGGCTACAGCAACAG
gttcattctgggatgggttgggggtggggaggcaaaagccaccctggcaggcccggacct
tttgtagtttctgtgggacgcgcatggctgaccgcctgcaaagaaaaacagcgcctccct
taagggtcaggtcccagtgagaggaccctgacagcccagctgggggtggaacgagggacc
EXON 2  95 bp
cagtccacgtggcccatggcaggtgctcaatggatgtttgctgaatgactgaatgtcgat
cataagttacagccacgccccatgggcagcaaggctctgtagctcatcctggactccagt
cacatcaacacctggcttctcccgggtggatccagtgaaccattttcttttggtttgaag
CCAGAGGTGTTCCTGGGGAGATGGCGGAACAGCACGGAGCACCCGAACAGGCTGCAGCTG
GCAAGAGCCATGGAGACCTTGGGGGCAGCTACAAG
gtactgggcagggagggggtcagagggcccaggctactcctgggcctcagggtcatcttc
ccagccaagcagcacctctgcaggaaggaagagccatccttccaaccacccaggccagga
caaaacgctccgggtgggtcctctcactgccaccctcccgttagaaacttgcttcatgac
EXON 3  119 bp
gttcctgaaggcgtttccctccatgaccattagagggcagtgcaggcccacctcagtgcc
agctccaggctggagagatgcagaaagcagagggtacctccctctaatgcccaaaggagg
ggcagaggctggagctgggagcctagcagaggtgggatgtttaggactctgctcttctag
GTGATCTTGTACGAACTAGAGAACTTCCAAGGCAAACGCTGCGAGCTCTCGGCCGAGTGC
CCCAGCCTGACCGACAGCCTGCTGGAGAAGGTGGGCTCCATCCAAGTGGAGTCCGGGCC
gtgagtacctagacccccagtccctcgccacagccctgagccttctgggagtgtggaggc
cccagtctgagctctagatctgttgtggggcttttgacagctcccctgccttctctggcc
tcgttttccgcatctgtaaaatgagagttgaagaattctctagaatcctagatgtctgca
EXON 4  133 bp
ctcagacagttcccggtatgtcctagcagctcctttaattacaggtccaggaattagcag
tagggttggagggagggtacaaggttcaaggtcagcagctcttggacacttctctcacta
aacttgaatccttcctcagctgcagcaaaggtgacccagccaagcctcttcctccctcag
GTGGCTGGCATTTGAGTCCAGGGCCTTCCGCGGGGAGCAGTTTGTTCTGGAGAAGGGGGA
TTATCCTCGCTGGGATGCCTGGTCCAACAGCCGTGATAGTGACAGCCTTCTGTCCCTCCG
GCCTCTGAATATT
gtgagtgtggttcctgctcacttctgggtgttcctggaagcagggtgcactgagagctgg
tcaggcagctcattgcacaagctgggctgagggtttggcccatatggacctggcctggga
agggccctcatgtttctgatttgaacaattgtgtgggacaagaagtgggatattgaaggg
EXON 5  143 bp
ccgtccctcctacagtgaatttgggggtggaggcatctcctgaggcccttccctcctgca
gcaggtttgggggtgggtgttattttgtggtgacctgttgattctttccggcatctggag
cctccttgacctctgttctggatatgggagcagccgctcaccccacgatattgccctcag
GATAGTCCACATCACAAGCTGCATCTGTTTGAGAACCCAGCTTTCAGTGGCCGCAAGATG
GAGATAGTGGATGATGACGTGCCCAGCCTGTGGGCTCATGGCTTCCAGGACCGTGTGGCG
AGTGTCCGTGCCATCAACGGGAC
gtaagggacccaaccctcacccttgccccatcttctggtcagccatgcctctggctccaa
acagaatcagtgcccatagtttcttattattttatttatttatttatttatttttgagac
ggagtcttgctctgtcgcccaggctggagtgcagtggcgcgatctcagctcactgcaagc
EXON 6  311 bp
gataaggctagagatgctttgttaagggtcctgtgagcagggtaaagagtttggattcat
cccaagggctctggggagctaaagaggaatgtaggcaggcagagtgcatggtcagatgct
ggctggaggcagggtgactggaagcagaccgtccacatctcaaccttggtctcccggcag
GTGGGTTGGCTATGAGTTCCCCGGCTACCGTGGGCGCCAGTACGTGTTTGAGCGGGGCGA
GTACCGCCACTGGAATGAGTGGGACGCCAGCCAGCCGCAGCTGCAGTCTGTGCGCCGCAT
CCGTGACCAGAAGTGGCACAAGCGGGGCCGCTTCCCCAGCAGCTGAAAGGCACCCAGACT
TCAAGGACCCAGACCCACCCTGGGGGGCTGCAAGGGCAAGAAGAGGAGGCTCCAGGGTTG
GGGCGAGGGCCGACCTGTCCACCCTTCCCTGGAATCTGCTCAATAAAGCCTGGGGTTGGT
CCCCCACCCGC
cacgttcctcggcatcacttcctgagggagccaggcctggggcgggacctgtgggagagg
cgtgctgaaggaggctggggcttgagtgttctgagactcccaggaaggggctgggaaatt
tgcccatatcctaggctctaatcctttcaggcagagccatgtgcccctactgccctgatc