Gene CRKL Variant 1
DNA : 32.88 KbNT_011520
mRNA : 1880 bp NM_005207
CDS : 912 bp NP_005198
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  820 bp
gagtgcctaccgccggcgcctcttcagcctcctcctggaacgcgggagcgggcgcgacca
gcgcccaccctgatcgtcgcgacggtgctcctgattggctgcgctgtgtgacgtaacggg
agggccccggcggccgccgggagccggggcccagcgcgtgcgcagacggagcgcgctgag
CGGAGGGGGAGGTGGCTGCCGCTTCTCCCGCGTCCGCCATTTTGTTGCTGTGGCTATTGG
GAACAAGCTGGGCAAAAGCACCCCGGAGGCGCGACGCTCCTTCGAGTTCGGTGCCTCGTG
TGACGGCGGGGGTCGGTGAAGACCCGTCGAGCTGCGGCGCCGGCGCGTTCCAGGCCGGGA
GTCACTGGAGGCACCCCTGGGACGCCGAGCAGCCCGAGAACCCCGGGGTGGCCTCCGCTG
CGGCTCGGGTTTGCCTGCCCCGACCCCCCGGCTCTGCCGTGCATTCCCGGGCGGCTCTCT
CCGTGTGGCGGCCCCGGAGCAGGCGGGCGGCGTCGGAGGATGCTGCGGGCCCGGAGCCGA
GAGGAAAGTGCTGGCCCAGCCCTCTGAGCGCTCCTCGAGGTGTGCGAGAGGCCCTTCCTC
GGCCCCAAAGCCGTCTGCCGGGCTAAGGCGTGCAGAGCAGGCGAGGACAGCCGCCGCCCC
TACCGCCGCAGAGTCCCCGGTCCAACACCATGTCCTCCGCCAGGTTCGACTCCTCGGACC
GCTCCGCCTGGTATATGGGGCCGGTGTCTCGCCAGGAGGCGCAGACCCGGCTCCAGGGCC
AGCGCCACGGTATGTTCCTCGTCCGCGATTCTTCCACCTGCCCTGGGGACTATGTGCTGT
CGGTGTCCGAGAACTCGCGGGTCTCCCACTACATCATCAACTCGCTGCCCAACCGCCGTT
TTAAGATCGGGGACCAGGAATTTGACCATTTGCCGGCCCTGCTGGAGTTTTACAAGATCC
ACTACCTGGACACCACCACCCTCATCGAGCCTGCGCCCAG
gtacgcgagagccctccccgaccgcggaggaaggtcgagaaccgggtctgtcgaagagtg
cttgtataggggggtggggcgcgcttgaacccatattccccgcattctgaaccaaattat
tttccagaaggccttcctaacagaaagctagtgtcaggatctgggtcactggataagagg
EXON 2  466 bp
cagagtttgcagtgagctaagatcacgctattgcactccagcctgggcgacaagagcaaa
acttgtctcataaaaaaggaaaataatttattatagaggagagtggtatattaagaagtt
tgacaggcactggcttagagtaagatttttctcttagagtaattttctttctctcttaag
GTATCCAAGCCCACCAATGGGATCTGTCTCAGCACCCAACCTGCCTACAGCAGAAGATAA
CCTGGAATATGTACGGACTCTGTATGATTTTCCTGGGAATGATGCCGAAGACCTGCCCTT
TAAAAAGGGTGAGATCCTAGTGATAATAGAGAAGCCTGAAGAACAGTGGTGGAGTGCCCG
GAACAAGGATGGCCGGGTTGGGATGATTCCTGTCCCTTATGTCGAAAAGCTTGTGAGATC
CTCACCACACGGAAAGCATGGAAATAGGAATTCCAACAGTTATGGGATCCCAGAACCTGC
TCATGCATACGCTCAACCTCAGACCACAACTCCTCTACCTGCAGTTTCCGGTTCTCCTGG
GGCAGCAATCACCCCTTTGCCATCCACACAGAATGGACCTGTCTTTGCGAAAGCAATCCA
GAAAAGAGTACCCTGTGCTTATGACAAGACTGCCTTGGCATTAGAG
gtaaaatctgttcagattagctttttgggtcctttgacatttggttttaatttttagttt
tagtttagtttctgctcatttaagcttatattcatggaattagagcactggatgattttg
gaagatacgcactgttagcgtttcattttaaaatttttttatagagacgaggtctctaat
EXON 3  594 bp
gttagaggttacattgagcagggatctcaccactacactccagcatggctaacagagtga
gaccctgtgtctaaataataatgtatgggccctttggataaggtagtgtttgtgatttaa
tgtaaactgtctttttcttgttgcagagaaatgctaactttgtcttcttcatccatacag
GTTGGTGACATCGTGAAAGTCACAAGGATGAATATAAATGGCCAGTGGGAAGGCGAAGTG
AACGGGCGCAAAGGGCTTTTCCCCTTTACGCACGTCAAAATCTTTGACCCTCAAAACCCA
GATGAAAACGAGTGATTGCTGTTGCCCTGTTTCCTGCTGCTTTGTTGTTCTGCCTGTCCT
AGTCTCCTTTGAAGTGGGAAAGCATTTTCTCTCATAGGCAAGTCACACTGCATTGCCGAA
GTCCAGCTTTCTGCAGACTGGCAGTCGCACACACATTTGGAATGCACACAGCGGCTGCCT
CCTGATGTTTGTATCATAGTCGTATTGTCAAAGAGTAGCCGATTTTAGAGTTCTTTTGGA
TCATAAACTGGAAATACTGATGGAAGCACACAAGTGGAGAGAAGTTGACATGGAAAGGGT
CTTCCTTCTCATTGCTGCCCGTTTGTACATGGGACTGATTCTGTTGTGTTCACCAGAGAA
AGCTTGAGGCCATGGCGAGATACTGCATGTTTGCTGTTCCACAAAGCAGTGGCTTAGCTG
CCATCTTGCTTTTCTTTGGACAACAGGAAGTGAACCTTAAGGAAGAGAGAATTC
tgttctaaaactccaaaatctggcttttttttttcttttgttttggtttggttttggaaa
actaattaattagacttgtgtgggggtttttttttgttttgttttgtttgttttgttttg
tttttttgagacggtgtctcgctgcatcacccaggctggagtgcagtggcgcaatctcgc