Gene COMT Variant 2
DNA : 6.46 KbNT_011519
mRNA : 1067 bp NM_007310
CDS : 666 bp NP_009294
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  269 bp
tggcgctgacacgtcaggcaactgaggcacaaggctggcatttctgaaccttgcccctct
gcaaacacaagggggcgatggtggcactccaagcaaaggggcgtgtgggtgctgcaggag
gagcacagagcactggcgcccctcccctcccgccctgcagatgccggaggccccgcctct
GCTGTTGGCAGCTGTGTTGCTGGGCCTGGTGCTGCTGGTGGTGCTGCTGCTGCTTCTGAG
GCACTGGGGCTGGGGCCTGTGCCTTATCGGCTGGAACGAGTTCATCCTGCAGCCCATCCA
CAACCTGCTCATGGGTGACACCAAGGAGCAGCGCATCCTGAACCACGTGCTGCAGCATGC
GGAGCCCGGGAACGCACAGAGCGTGCTGGAGGCCATTGACACCTACTGCGAGCAGAAGGA
GTGGGCCATGAACGTGGGCGACAAGAAAG
gtggggtccgggccagcaggtgctcagctctgggacagggacccaggaccaggcatcaaa
gcccttacaggagaagctgttatcaccccatttccagggggctgggaaccctgggatatg
cccagatagggctggggggctcctctggagtcccagggtgccagggtccctgatgacccc
EXON 2  194 bp
ggacaccagggaggtgaaatacccctccagcgggtagggagggtgggcagaggagggcca
gcggccaggcatttgggaggggctcctgctctttgggagaggtggggggccgtgcctggg
gatccaagttcccctctctccacctgtgctcacctctcctccgtccccaaccctgcacag
GCAAGATCGTGGACGCCGTGATTCAGGAGCACCAGCCCTCCGTGCTGCTGGAGCTGGGGG
CCTACTGTGGCTACTCAGCTGTGCGCATGGCCCGCCTGCTGTCACCAGGGGCGAGGCTCA
TCACCATCGAGATCAACCCCGACTGTGCCGCCATCACCCAGCGGATGGTGGATTTCGCTG
GCGTGAAGGACAAG
gtgtgcatgcctgacccgttgtcagacctggaaaaagggccggctgtgggcagggagggc
atgcgcactttgtcctccccaccaggtgttcacaccacgttcactgaaaacccactatca
ccaggcccctcagtgcttcccagcctggggctgaggaaagacccccccagcagctcagtg
EXON 3  132 bp
agggacagagtggggccttgtcatcccagaaccctaaagaaaactgatgaatgcttgtat
gggtgtgtaaagatggcctcctgtctgtgtgggcgtgggcactgacaggcgctgttgtat
aggtgtgtagggatggcctcctgtctgtgaggacgtgggcactgacaggcgctgttccag
GTCACCCTTGTGGTTGGAGCGTCCCAGGACATCATCCCCCAGCTGAAGAAGAAGTATGAT
GTGGACACACTGGACATGGTCTTCCTCGACCACTGGAAGGACCGGTACCTGCCGGACACG
CTTCTCTTGGAG
gtgagccccaaccaggatggcatccgtgccagctgctgcccagagcccattcagtcagcc
tcagcctctccaaagagccaggcattccagtagagccctgtgtggacacagctcgctctg
gaggcaccacctgaggtctgggagtgtgggggactgaggaggccctgtggtgggtggaga
EXON 4  472 bp
cccaagtcttgtacagtcctttcctgcaggagtcacgctgggcagaaagtggaaacctgg
ccccaggggctaggcacaggcgtggtgccgtggcctagtgaggagcacccatcctggttt
ggggcaggttctctgggcacctctgaccctcacctcccccaccccccggtctgtttgcag
GAATGTGGCCTGCTGCGGAAGGGGACAGTGCTACTGGCTGACAACGTGATCTGCCCAGGT
GCGCCAGACTTCCTAGCACACGTGCGCGGGAGCAGCTGCTTTGAGTGCACACACTACCAA
TCGTTCCTGGAATACAGGGAGGTGGTGGACGGCCTGGAGAAGGCCATCTACAAGGGCCCA
GGCAGCGAAGCAGGGCCCTGACTGCCCCCCCGGCCCCCCTCTCGGGCTCTCTCACCCAGC
CTGGTACTGAAGGTGCCAGACGTGCTCCTGCTGACCTTCTGCGGCTCCGGGCTGTGTCCT
AAATGCAAAGCACACCTCGGCCGAGGCCTGCGCCCTGACATGCTAACCTCTCTGAACTGC
AACACTGGATTGTTCTTTTTTAAGACTCAATCATGACTTCTTTACTAACACTGGCTAGCT
ATATTATCTTATATACTAATATCATGTTTTAAAAATATAAAATAGAAATTAA
gaatctaaatatttagatataactcgacttagtacatccttctcaactgccattcccctg
ctgcccttgacttgggcaccaaacattcaaagctccccttgacggacgctaacgctaagg
gcggggcccctagctggctgggttctgggtggcacgcctggcccactggcctcccagcca