Gene COMT Variant 1
DNA : 27.22 KbNT_011519
mRNA : 1290 bp NM_000754
CDS : 816 bp NP_000745
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  112 bp
acggggacaccctggccaccgccgcgcggacaccctcacgaggacaccccggccgcgcgg
acacctaccgcggggacgccccgaccccatcctacctgctgcgccccgcgccgcgccccg
caccccgcccgccacggcctgcgtccgccaccggaagcgccctcctaatccccgcagcgc
CACCGCCATTGCCGCCATCGTCGTGGGGCTTCTGGGGCAGCTAGGGCTGCCCGCCGCGCT
GCCTGCGCCGGACCGGGGCGGGTCCAGTCCCGGGCGGGCCGTCGCGGGAGAG
gtgagagcgctggctagaccggggccgaatgcggccggattcggggcgggggccttcaga
cctagggtggaacactgggatagggtgtggggaattcggaccgctgtgaagtgatctgac
gttgggtgggagtctccggacttggggtggggaatctggatgggaactggggaattcgga
EXON 2  91 bp
ctgaggccttctgctgtctcttctgaggccggaaaggcgaagcactgccctcgccctgct
agggaaggctcaggccaggctggccctatccggggaaggggctcaggtatctggaccttg
gtcatcgccaggttagggtttatgttgatgattatccaaaggcaaaattgatttccacag
AAATAACATCTGCTTTGCTGCCGAGCTCAGAGGAGACCCCAGACCCCTCCCGCAGCCAGA
GGGCTGGAGCCTGCTCAGAGGTGCTTTGAAG
gtgagttggccaacggaagccggggcagtgccagggtgggtacagattccggcccggtgc
atgggcacaggtctgctgagcacatgtccactctgcctgtgtaaataggccacatggcct
gaaatcccctagaagcctggtgtccgcatgacctccccctagggcggagcctctgcttcc
EXON 3  289 bp
gcacgagaaggctggctccctggcgctgacacgtcaggcaactgaggcacaaggctggca
tttctgaaccttgcccctctgcaaacacaagggggcgatggtggcactccaagcaaaggg
gcgtgtgggtgctgcaggaggagcacagagcactggcgcccctcccctcccgccctgcag
ATGCCGGAGGCCCCGCCTCTGCTGTTGGCAGCTGTGTTGCTGGGCCTGGTGCTGCTGGTG
GTGCTGCTGCTGCTTCTGAGGCACTGGGGCTGGGGCCTGTGCCTTATCGGCTGGAACGAG
TTCATCCTGCAGCCCATCCACAACCTGCTCATGGGTGACACCAAGGAGCAGCGCATCCTG
AACCACGTGCTGCAGCATGCGGAGCCCGGGAACGCACAGAGCGTGCTGGAGGCCATTGAC
ACCTACTGCGAGCAGAAGGAGTGGGCCATGAACGTGGGCGACAAGAAAG
gtggggtccgggccagcaggtgctcagctctgggacagggacccaggaccaggcatcaaa
gcccttacaggagaagctgttatcaccccatttccagggggctgggaaccctgggatatg
cccagatagggctggggggctcctctggagtcccagggtgccagggtccctgatgacccc
EXON 4  194 bp
ggacaccagggaggtgaaatacccctccagcgggtagggagggtgggcagaggagggcca
gcggccaggcatttgggaggggctcctgctctttgggagaggtggggggccgtgcctggg
gatccaagttcccctctctccacctgtgctcacctctcctccgtccccaaccctgcacag
GCAAGATCGTGGACGCCGTGATTCAGGAGCACCAGCCCTCCGTGCTGCTGGAGCTGGGGG
CCTACTGTGGCTACTCAGCTGTGCGCATGGCCCGCCTGCTGTCACCAGGGGCGAGGCTCA
TCACCATCGAGATCAACCCCGACTGTGCCGCCATCACCCAGCGGATGGTGGATTTCGCTG
GCGTGAAGGACAAG
gtgtgcatgcctgacccgttgtcagacctggaaaaagggccggctgtgggcagggagggc
atgcgcactttgtcctccccaccaggtgttcacaccacgttcactgaaaacccactatca
ccaggcccctcagtgcttcccagcctggggctgaggaaagacccccccagcagctcagtg
EXON 5  132 bp
agggacagagtggggccttgtcatcccagaaccctaaagaaaactgatgaatgcttgtat
gggtgtgtaaagatggcctcctgtctgtgtgggcgtgggcactgacaggcgctgttgtat
aggtgtgtagggatggcctcctgtctgtgaggacgtgggcactgacaggcgctgttccag
GTCACCCTTGTGGTTGGAGCGTCCCAGGACATCATCCCCCAGCTGAAGAAGAAGTATGAT
GTGGACACACTGGACATGGTCTTCCTCGACCACTGGAAGGACCGGTACCTGCCGGACACG
CTTCTCTTGGAG
gtgagccccaaccaggatggcatccgtgccagctgctgcccagagcccattcagtcagcc
tcagcctctccaaagagccaggcattccagtagagccctgtgtggacacagctcgctctg
gaggcaccacctgaggtctgggagtgtgggggactgaggaggccctgtggtgggtggaga
EXON 6  472 bp
cccaagtcttgtacagtcctttcctgcaggagtcacgctgggcagaaagtggaaacctgg
ccccaggggctaggcacaggcgtggtgccgtggcctagtgaggagcacccatcctggttt
ggggcaggttctctgggcacctctgaccctcacctcccccaccccccggtctgtttgcag
GAATGTGGCCTGCTGCGGAAGGGGACAGTGCTACTGGCTGACAACGTGATCTGCCCAGGT
GCGCCAGACTTCCTAGCACACGTGCGCGGGAGCAGCTGCTTTGAGTGCACACACTACCAA
TCGTTCCTGGAATACAGGGAGGTGGTGGACGGCCTGGAGAAGGCCATCTACAAGGGCCCA
GGCAGCGAAGCAGGGCCCTGACTGCCCCCCCGGCCCCCCTCTCGGGCTCTCTCACCCAGC
CTGGTACTGAAGGTGCCAGACGTGCTCCTGCTGACCTTCTGCGGCTCCGGGCTGTGTCCT
AAATGCAAAGCACACCTCGGCCGAGGCCTGCGCCCTGACATGCTAACCTCTCTGAACTGC
AACACTGGATTGTTCTTTTTTAAGACTCAATCATGACTTCTTTACTAACACTGGCTAGCT
ATATTATCTTATATACTAATATCATGTTTTAAAAATATAAAATAGAAATTAA
gaatctaaatatttagatataactcgacttagtacatccttctcaactgccattcccctg
ctgcccttgacttgggcaccaaacattcaaagctccccttgacggacgctaacgctaagg
gcggggcccctagctggctgggttctgggtggcacgcctggcccactggcctcccagcca