Gene ARVCF Variant 1
DNA : 46.89 KbNT_011519
mRNA : 4017 bp NM_001670
CDS : 2889 bp NP_001661
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  198 bp
gaggcccaatggcaagccgtcatctccgcgcatccgcccaatcggcgccggttgccgtgc
cgcgccgggtctctcgaccaatgggaaaatttgctgtcagatggggcggggcggagattc
gcgtcgccggcccggtccgctttgcgcacgggccgcgtgagggcgggagggctggcccgg
GGTCTCGGGTTGCGCGCTGGGCCTGGAGGGAGGGGGCGGCCCCCGCACCGGTCCGAGTTG
CGGCCGCGTGGACTGCGACCCGCGCCGCGCCGCACCGCGCCGCGCCCTGGGAACGCCGCT
CCCCGCGCGCCAACGGACCCGGGGAAGCCCTTCTGGGGTCCGAGGCCGCGCTGCGGGGCC
GCCCACGCTGCGCTCCAG
gtaagcctgagccagtgggcggggtgtgggacccggggctggggcctcgggtcggagccg
ggactgggggcggggctgcagatatgggacgcattccgggcagcggtccggacagggtcc
tatccctggagtcgagatccgggcgagggtctgggccggacgtcggagccaatctccgcc
EXON 2  54 bp
atgtgggggcaagaaggtacacatgagtgtgtggttatgagtcaggagcaccacgggatg
accttcagatcaggcatgacaaggtcctgcttagaggacggtctgggcttgtgtaccttt
atccggcagggacctacccagctggattgacctcactcatgccctctggtttccctgcag
GAGCCAGAGCCTGCAGGGTGGGTGTCGGGACATGCTGATCTTCCCTCAAGACAG
gtgagtggcctgggtttagcttggggacatcctctcccacataggacagcagagtgttct
ggtgggcctggcgggtgggggtgacagggatggactggccctggacactgtgtgctcctg
gtccttctcaccctgggtaggcacagcccctgggctggacagggtggatgtgagggcctc
EXON 3  228 bp
cggccagcctcggattaatggcttttaatttagaatttaatcagtgtgcttccctctaga
gggctggatgctctggtctgggagtgagttgtatggtctgtgagtggggcgggcaggggc
ccatgatggccttgccaggctgtgccccaccccactgagcttactctgctttgcctgcag
CTGGCGGGCGCTCTGGTCATGGAGGACTGCAATGTGCACTCGGCCGCCAGCATCCTGGCC
TCGGTGAAGGAGCAGGAGGCCCGCTTCGAGAGGCTGACACGGGCACTGGAGCAGGAGCGG
CGCCATGTTGCCCTACAGCTGGAGCGTGCCCAGCAGCCTGGCATGGTCAGTGGTGGCATG
GGCAGTGGGCAGCCCCTGCCAATGGCCTGGCAACAGCTGGTCCTCCAG
gtaacagcctagtgacttgggaagggtgaaaattgccaagtgggaaaacaatcagtgggt
cctggtggaccacaagccagcatgcgctcgcttattgcaagatttgctggggctcctggg
gaggaaaggaaaatgggatcccaggttgggctggaagtcccacttgggtgtactaggcac
EXON 4  159 bp
ttgctgtccttgtcagcttgggccgaaacaggccttggggtgggtgggttcaggaccagg
aggaaggcaccctggtgtgctggccagcatgagctgaggcagagctgctgtgtgtggaga
cctgcactccaggggtgactgagcagcaggcctgcccaccaatgtccctccttgccccag
GAGCAGAGCCCAGGCAGCCAGGCCTCACTGGCCACGATGCCGGAGGCACCTGATGTGCTG
GAGGAGACCGTGACGGTGGAGGAGGACCCCGGCACACCCACTTCCCATGTGTCTATTGTC
ACATCCGAAGATGGCACAACCCGGCGCACCGAGACCAAG
gtatggccaggcccaggcagtgggtgggtgagcagggccaggctgctgcagctgtcccac
ctgcagagtggacatggaagcttgccacgtggggcctctcattgctcgagtgggaaatta
aggccagccagaccccagcaaagcagtttctaggcctctcgtgctaccccacctacctgc
EXON 5  527 bp
ggcagtgggtgggtgagcagggccaggctgctgcagctgtcccacctgcagagtggacat
ggaagcttgccacgtggggcctctcattgctcgagtgggaaattaaggccagccagaccc
cagcaaagcagtttctaggcctctcgtgctaccccacctacctgcctatccatccaccag
GTCACCAAGACTGTCAAGACGGTGACCACTCGGACAGTACGCCAGGTGCCCGTGGGCCCA
GATGGACTCCCCCTGCTGGATGGCGGCCCCCCACTAGGCCCTTTTGCAGATGGTGCCCTG
GACCGGCATTTCCTGCTGCGTGGTGGTGGCCCAGTGGCCACACTCTCTCGAGCCTACCTC
AGCAGTGGGGGTGGCTTTCCCGAAGGCCCCGAGCCCCGGGACAGCCCCAGCTATGGCAGC
CTGTCCCGAGGGCTGGGCATGCGGCCCCCACGTGCTGGCCCCCTTGGCCCAGGCCCTGGT
GATGGCTGCTTCACACTGCCTGGCCACCGGGAAGCCTTCCCGGTGGGTCCTGAGCCTGGG
CCACCAGGTGGCCGCTCCCTGCCCGAGCGCTTCCAGGCAGAGCCGTATGGCTTGGAGGAT
GACACGCGCAGCCTGGCCGCTGATGACGAGGGTGGCCCTGAGCTGGAGCCTGACTATGGC
ACGGCCACAAGGAGGAGGCCTGAGTGTGGGCGGGGCCTTCATACCAG
gtgagctgcaccccgtcccctgtggctacctcctctgggaagtctgccctccacccccca
actacagagtgccccacttgtcaagtggcgcagttgagttagtcatgcatgttagtttga
attggccttggctctcgtcagggacagaagaaaggtggaccctggggtggtaggagttcg
EXON 6  500 bp
tctcactgggctggtgcatgactctctgtgtccccaccatgctccgggccaagatacagg
tgctctcagcccagcgctgctgggtgagtttgcagtcctgaagaaggtgtgatggggcag
ctcagaggcagggctggcggctgctgtgacgatgtccacgcgccccacttgcctgtgcag
GGCCTACGAGGACACAGCAGATGATGGCGGCGAGCTGGCGGACGAGCGGCCTGCGTTCCC
AATGGTGACGGCGCCCCTGGCCCAGCCTGAACGGGGCAGCATGGGCAGCCTGGACCGGCT
GGTGCGGCGCTCGCCCTCAGTGGATAGCGCCCGCAAGGAGCCGCGCTGGCGGGACCCTGA
GCTGCCTGAGGTGCTGGCCATGCTGCGGCACCCCGTGGACCCCGTGAAGGCCAATGCGGC
CGCCTACCTGCAGCATCTGTGCTTTGAGAACGAGGGTGTCAAGCGGCGTGTACGGCAGTT
GCGGGGGCTGCCGCTGCTTGTGGCACTGCTGGACCACCCGCGGGCTGAGGTGCGGCGCCG
GGCCTGTGGGGCACTGCGCAACCTCTCCTATGGCCGCGACACTGACAACAAGGCCGCCAT
CCGGGACTGCGGTGGTGTGCCTGCCCTGGTGCGCCTGCTGAGGGCTGCCCGGGACAACGA
GGTCCGTGAGCTTGTCACTG
gtgagtgggacctggccatgctcacatcccctgggaagagaagagtgtgaggctcaaccc
gggaggaacgaggccactcggcctgcgaccgcctgggaaagcacccggtaggcaggagtg
cagctgctgagacgcttgccccaggagccaggcatcaggcccagacactgtgacaggttc
EXON 7  184 bp
cttcctagctggaaaccagtactgggtgtcccccggaaccactcacggcttttgttactt
cctactgttctgcatgagctgggacatgaggagagtgggacaggtcctgagcgtggccac
ctggggaggtaggcaggcggtgcatatggtcagcacagattggccaatcgcaccccacag
GCACCCTGTGGAACCTGTCATCCTATGAGCCCCTGAAGATGGTCATCATTGACCATGGCC
TGCAGACGCTGACCCACGAGGTGATCGTGCCCCACTCAGGATGGGAGCGTGAGCCCAACG
AGGACTCCAAGCCACGGGACGCCGAGTGGACAACTGTCTTCAAGAACACGTCGGGCTGCC
TGAG
gtgtggaccagacctggtgctaaagcccacatgcacaccaggccccgtcctcgtggtccc
agatagtgtggaagatggcggcgagcttaggagcgccagagcttaggagcttcagagctg
tggcacaagtcctgtggatgagaagtggggcctgatggagctgtcctcacccccaagtgg
EXON 8  118 bp
cctgggggcagttagcttctcccccttcactgagctccagactgtggggtcctttcccat
tagtgctaggagggcagcagcagggcctattttgcagatgaagacaagcccacaaggcca
gggtggagccagggagtttctggtagccaggggtcacctggcctgctcttggccacacag
GAATGTGAGCTCCGATGGTGCTGAGGCCCGGCGGCGACTCCGGGAGTGTGAAGGGCTGGT
GGACGCGCTCCTGCATGCCCTGCAGTCGGCTGTGGGCCGGAAGGACACTGACAACAAG
gtgggcagggacggtcacagcctcataccaagggctggagagacgatcatgcaggtccca
ggaggctggaactgtgggagcagcacaggggaatgggcttgtgggtctggggtggcgttc
tgggtgtggcccgcctcgcagtgaccacactgaagtgggcaccgtcctgcaggcagaagg
EXON 9  172 bp
ggcagaggcttcctcccatggacccttcctggcggttaccgcccttttgctcccctccac
tgaggactccctgttcctttgctcccggtgccctcatgcacaccagctgtggccagtctt
tcctgagggccagccctgtgcctagggtgccctgccccacccactcacctctccctgcag
TCGGTGGAGAACTGCGTGTGCATCATGCGGAACCTGTCCTACCACGTGCACAAGGAGGTG
CCCGGGGCCGACAGGTACCAGGAGGCCGAGCCCGGGCCCCTGGGCAGTGCTGTAGGCTCC
CAGCGCCGGAGGCGGGATGATGCCAGCTGCTTTGGAGGCAAGAAGGCCAAAG
gtgggtggggcggactggggtatcatctctaccatctcaactcctgccccagcggaaggc
tctctgtacacccacagcagcccatcatggaggctagaggacacctggtcagcccccaac
aggcaggcagggaagccaggagtcaaggaggctggactgccctgggtcacatggttgatg
EXON 10  18 bp
cttcttgtacccctggtgggtgctcagtgcccagaagtgatgggatgaggttccacatgc
tgcctgcttgatccagggtgtgcagtgggaacctgaggcttccgggagggcatggggggg
tgatgagtgctgcctgttcaggctcctctcctctctcctctgcttcctccggcctcccag
AGGAGTGGTTCCACCAAG
gtgagtccctttttatcctgctctccaggcctggcgtgtgcagtgggtacctgggaagag
gcgagcacgttccagccccagggccctgccccacccctggcttcatcactcgggctgcca
tctttatgacagtggcaggtgggaaggccacggggctcattctgtaacctcagacttgcc
EXON 11  72 bp
acccctaggctaaactgtctgcccaaactctgacaacggtgctccactcccacaggtgcc
caggcctggacatgggggtgccttttggggcctgggtaggagagaactgtgcccaactct
cctgatacacccattccccatatggggtctgcctcacctcccaccacctttcccttccag
GAAAGAAGGATGGTGAGATGGACCGGAACTTTGACACGCTAGACCTGCCCAAGCGAACTG
AGGCCGCCAAAG
gtgagtgggctgagatgaagccagctccactgggggatgtctgggctcaggattgccctg
gtagtgaagctttgagccatcaagcaggcctggagggcctcagggaacagatggggaaac
aggcccctaggtgcaggatttcctggagggtgattcagcaccaggacacctgctgagggt
EXON 12  128 bp
tgggaacgcttttccccttgggtgactatatgttgatagtaaatattacgtgactcatcc
acacccatccctggccccagctcacccacgccctgggagctctgaagcgggaagcgggag
gggtatgatggatgagagcagattctgggtgaccgtgggtggcggttgccctgcacctag
GCTTTGAGCTGCTGTACCAGCCCGAGGTGGTACGTCTCTACCTCTCCCTCCTCACGGAGA
GCCGGAACTTCAACACCCTGGAGGCTGCCGCCGGCGCTCTGCAGAACCTCAGTGCCGGCA
ACTGGATG
gtgagggaccaggtcgggcagggtgggcaagtcctgagagagggaatcccaggcacctca
ctggtgcagctcctgcctcggctggcggggaaaggaggggccacaccaccaccccaggat
ccaagaggtgtatgggctgcgggcaatgcgtgcaccctggacggtgggaaaacctcggtg
EXON 13  151 bp
gcgggcaatgcgtgcaccctggacggtgggaaaacctcggtggaggtgccgttgagcttt
tggggtagggctttgtcgggcacgggagcaggaaggtccagctggagagagcggtcagcg
tctggaggtgggagagtgcctggcatgtatgtctgagcaaccctctccccgcctccgcag
TGGGCCACGTACATCCGCGCCACAGTGCGCAAAGAGCGCGGGCTGCCGGTGCTTGTGGAA
CTGCTGCAGTCTGAGACCGACAAGGTGGTGCGCGCCGTCGCCATCGCTCTGCGCAACCTC
TCGCTGGACCGGCGCAACAAAGACCTCATCG
gtgaggacgcctgcaaagcccacgcctgggcaccgaactgtgcctgcagctttggggtcc
catcggaggggcttggaggatgagtggtttgggagtccaggccccggccctctcgcttgg
gcgctgtcccaactggaggtagctccagtccccccggccctgtctctgaagctcagcgcc
EXON 14  199 bp
cagtccccccggccctgtctctgaagctcagcgccctgctcacaggggctcctgtgaccg
cctgcacacaggcggtctccaggggctctcctggcagtgcccctcgccctcgcgggatcc
ctgctccttcctggagaggtggggcagaggtgtgttctgacacctagtcctgcccctcag
GGAGCTACGCCATGGCTGAGCTTGTGCGGAATGTGCGCAATGCACAGGCTCCGCCGCGAC
CGGGGGCCTGCCTGGAGGAAGACACCGTGGTGGCGGTGCTCAACACCATCCACGAAATCG
TGTCCGACAGCCTGGATAACGCGCGCTCGCTCCTGCAGGCACGCGGGGTGCCAGCGTTGG
TGGCTCTCGTGGCCTCCAG
gtgtggaggggcggggtcggtggcttggggagccgcggaggtgggggaggggccaccact
gaccccgcccccggccccacagccaatcggtacgcgaagcgaaggcggcgtcacacgtgc
tgcagacagtgtggagctacaaggagctgcgtggtaccttgcagaaagatggttggacca
EXON 15  112 bp
aacaccatccacgaaatcgtgtccgacagcctggataacgcgcgctcgctcctgcaggca
cgcggggtgccagcgttggtggctctcgtggcctccaggtgtggaggggcggggtcggtg
gcttggggagccgcggaggtgggggaggggccaccactgaccccgcccccggccccacag
CCAATCGGTACGCGAAGCGAAGGCGGCGTCACACGTGCTGCAGACAGTGTGGAGCTACAA
GGAGCTGCGTGGTACCTTGCAGAAAGATGGTTGGACCAAGGCGCGCTTCCAG
gtgcggcttccctggccttccttccattccctgctcactttgccttattcccactccatg
tgcttcacccaccctgtgtctgtgttttatgtctcagtcagctgctgctactgccaaggg
gcctaagggagcactgagtcctgggggcttcgatgacagcacgctgccactggtggacaa
EXON 16  91 bp
cacacgtgctgcagacagtgtggagctacaaggagctgcgtggtaccttgcagaaagatg
gttggaccaaggcgcgcttccaggtgcggcttccctggccttccttccattccctgctca
ctttgccttattcccactccatgtgcttcacccaccctgtgtctgtgttttatgtctcag
TCAGCTGCTGCTACTGCCAAGGGGCCTAAGGGAGCACTGAGTCCTGGGGGCTTCGATGAC
AGCACGCTGCCACTGGTGGACAAGAGCCTTG
gtgagtggtggagcttagggagcctagagggtggcgaccccagctgccccagttgcctga
cccttgggtgaaggtgaaggaggagtcaggcctcccactgagacggcttccataggccac
tttccctgccctctgcctcttggctactcccttcccacagcatccgcgctgttgtcaagc
EXON 17  54 bp
actcccttcccacagcatccgcgctgttgtcaagctggggtgaggctgccagctggcaga
ggttgggcaccttagtgacagagagcctctagggctacctgggccagccctgtgtgggct
tctctgccccgatcccccctggctgccacatgcagcccgtctcctcctcctgccttgcag
AGGGCGAGAAAACTGGCAGCCGGGATGTGATCCCCATGGATGCGCTGGGCCCAG
gtgagtgcagatgcagtgtggttggttttctgtgccgggaggggaccaaggcctgaagtg
ggcctgctggttttatggggtgtagatggtgctgggtggaggagagatatttggtttagg
ggtgcttagagggtgaggtacagggcagctagagagggattagtgctcagccaggggctc
EXON 18  86 bp
agagttggcagggtgttggtgagagctggcaccagcctggatctccaggacagggtgggt
gggggctgtctcccaaagcccctgtcccacgagtcccctgtgtctgggctgagagggaga
tctgctcctacagggcctccctcagagcgcccctcatgccccaccttaccccatctacag
ACGGATACTCCACGGTGGACCGGAGGGAGCGGAGGCCACGGGGCGCCAGCTCTGCAGGAG
AGGCCTCTGAGAAGGAACCCTTGAAA
gtaagtggtcatgtggctgtgggcaggtccccggtgaggccccgtgtctaggggttgctg
gagagcagcctaggccatgctgggtctggtctgggccctggggtacagctgggttgtggg
gccaagcccaggaagcagccccttcacgccagtcagtctgtgggtactgacaagtttgca
EXON 19  120 bp
gcccgccctgggcccgtgtgagccacacgtttccggctccctgcgcccttggtgctacct
gtgctgtcctggcaggccaacccttacatcgccagcctcggccctgcccctgccctgtcc
ccccaggagctctaactaacctgctctattgtgcctctaatgcccacccgtgcgctgcag
CTCGACCCCAGCAGGAAGGCCCCTCCCCCCGGGCCCAGCAGGCCCGCGGTCAGGCTGGTG
GACGCCGTAGGGGACGCTAAGCCTCAGCCCGTTGATTCCTGGGTCTAGCTTGCATGCCTG

gtacgttctctcatctggttgttcgtccacctgttcctgccctctgggccagggcttctt
gttagtctccgctgcctgcacgctctgctcttcccgcacgttccccgcaggactttggcc
tccagtccagcagcccagtggcccattcccggaaagaccaggcagaggtcagagagggag
EXON 20  846 bp
caagtcaggatcagccctggtgccaagacccttggggtcagcccacaccacccagggcag
atgcttctatccacatctccatccatgtagcctgtggagttggctgccctgccctgaggt
tacacgtggtcctgtgccactcagtggctgcagcgtccaccatcccctttccctctgcag
GGCCCAGGCCCAGCCTCTTGTTCTTAGGGCTTGGATCGTGGAAGAAGGGCCACCCTGAGC
AGATCGTGCCGTGGAGCTTGGAGCCCCCTGGCGGCAGGGGTTGGCAGCGCCTCGCCCCAG
CCAAGCCTGACTTTGGGGACACCCTCCTGCCCCCCCACCCCACTCCCCCCATCCTACCTA
ACTCCCTAGGCCTGAGTTAGCTGTTTACTGACATGGTGCTGTGTGTGAGCGAGTGACAGA
AGGCCCGAGGAGGCCGACTGGGCTGCTGGGGCAGGGCCCAGGGAGGTGGCAGGGAAGGGT
GCCTGGCTGGGCTTTGGGGCTGGTGGGATAGGAGGGTGCCCCTGGGAACACAGTGCCCCA
GTGGTGCGGGCCAGGTCTGGCGCCAGGGGCAGGCAGCTAGGCAGGGAGGGGGCTGGGAAA
GAACTTGGACTTCTAAAGGCGGAGGGTCTCCCTGGGCACCCTGCAGGCAGGCAGACCACG
GTGTGGGGGGTGCCCCACAAGGCCCAGCCCTGGGCAAGGAAGCTTTGGAAGCAGCAAGGT
GGGGGTCAGGCTACAGGTGCCCCACCTCCCCAGAGCCCTGCAGTCACGTGAGGCCCCTGT
GCAGTAGAGAGCCTTTCTCCAGCCCATGCTGGCTGGGGCCGGGGCTGCCGCATCTGCCTG
GAGCCTGGGCAGCACCTCCGGGACTGACCTTCGGCAGTGGCTGGGGGACTGCTTTCAGTG
CCTGCTGTTCGTGACTCAGAAACAGAAGAAAAACACTGAGAAAAAGCATTAAAAATAAGC
CAAAATAAGACTATTGGTAAACACCTAAATTTTTGTAAGAAAATTTAAAAATTAAAGCAG
CAAAGG
aactttttgctttctgccactcaggtctggcacaagtggctggcttctcccttgtgtcgg
gcctctgcgcgtctggggcagggccctgggtggaggtggtcccaggtgcccatctgctgt
gtcctgcagaggctctgtttctggtccctgggtggccccaaacttgtccacttgggctca