--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8411 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1249       1475   0    Initial    227    74        Good
tccatagccacggtcctgaaacgccccgccgggcaggccggaccaatggacgccgagctc
ggccgtgcgtcacgcgacgctggccaatcgcggagggccacgaccgtagaaaggccgggc
gcggcgaggctgggcgctgggcggctgcggcgcgcggtgcgcggtgcgtagtctggagct
ATGGTGGTGGTGGCAGCCGCGCCGAACCCGGCCGACGGGACCCCTAAAGTTCTGCTTCTG
TCGGGGCAGCCCGCCTCCGCCGCCGGAGCCCCGGCCGGCCAGGCCCTGCCGCTCATGGTG
CCAGCCCAGAGAGGGGCCAGCCCGGAGGCAGCGAGCGGGGGGCTGCCCCAGGCGCGCAAG
CGACAGCGCCTCACGCACCTGAGCCCCGAGGAGAAGGCGCTGAGGAG
gtgggcgaggggccggggtctggggccagatctgaagccgggactagggacaggggcagg
ggcaggggctgggagcggggacccagcactggccgccccgcagggctccgtcgcctttgg
cctggcgggtcggtgccagcgtggcgcggggcggggcaggaagcccggactgaccggatc

Exon  2 +       2620       2731   2   Internal    112    99   Excellent
attgacagaagactgtattttttattttgttttattgaggggaggagcctgaagtgtatt
ttatcattagtctgtcttatactgtaaataaaaatgaaagcaccagctggtaaagttttc
aaataaagacataaataaggtttgatatgactcagtgtggtatgttccttctcttcctag
GAAACTGAAAAACAGAGTAGCAGCTCAGACTGCCAGAGATCGAAAGAAGGCTCGAATGAG
TGAGCTGGAACAGCAAGTGGTAGATTTAGAAGAAGAGGTAAAACTACTTAAG
gtcaaactcttttatccattgtatacccttccttggtgaatgttctgatatttgcttccc
atcccaagttgtttcagcccctattagaatacaattgaatatatgattaaaagttaaact
aggctgggcatggtggctcatgcctgtaatcccagcactttgggagcctgagttgggcag

Exon  3 +       4568       4726   0   Internal    159   100   Excellent
ttattaagtagcttgcttttccataattatggcctagctttttaaaacctactatgaaca
ccacaagcatagagttttccaaaagttcaagaaggaaaggaaaccaattatactgaatca
ggtagattcttaactgaaataattagatgttttaatagcctcttatgaactttcttccag
AACCAAAAACTTTTGCTAGAAAATCAGCTTTTACGAGAGAAAACTCATGGCCTTGTAGTT
GAGAACCAGGAGTTAAGACAGCGCTTGGGGATGGATGCCCTGGTTGCTGAAGAGGAGGCG
GAAGCCAAGGTAAATCATCTCCTTTATTTGGTGCCTCAT
gtgagtactggttccaagtgacatgacccagcgattatgtttacagtctggacttctgat
caagagcgttcttgaaattttccttcagttttaagacattttcatgcaggcagagtgttc
ttcccctaaaggcacttgacactcattttttaagtgtgtagtgaacagtactaagatcta

Exon  4 +       5581       5726   0   Internal    146    74        Good
gcaaatatcttatcttgctcttctcaataataataatgttgttagataataaagttctat
agcaatttaaccctagaatctttttgaaaagtaattctttaaagttgagaatcacagctg
tctagcaagcatttccttgggcacttgaagctgtttattcactttggtctttcctcccag
GGGAATGAAGTGAGGCCAGTGGCCGGGTCTGCTGAGTCCGCAGCACTCAGACTACGTGCA
CCTCTGCAGCAGGTGCAGGCCCAGTTGTCACCCCTCCAGAACATCTCCCCATGGATTCTG
GCGGTATTGACTCTTCAGATTCAGAG
gtagggatcattctgacttattaaagagctatataaccagttaattccatctgtttgatg
cttgacatccctaactagacagatgagggttgaagttagtttttggtggggttggaggtg
aacatcaactaccttcctagttccaggtaatatagaacatggagtgaagtgtagataaat

Exon  5 +       6041       6598   0   Terminal    558    85        Good
tcctagttccaggtaatatagaacatggagtgaagtgtagataaatgggtctggtgggtc
ccgaggtcatcttatcacataatgactaatttacattatggaacccagtacaaagtgttc
cagttagattttccattgtattctgacagttgtacttcatttaatttttgcctcttacag
TCTGATATCCTGTTGGGCATTCTGGACAACTTGGACCCAGTCATGTTCTTCAAATGCCCT
TCCCCAGAGCCTGCCAGCCTGGAGGAGCTCCCAGAGGTCTACCCAGAAGGACCCAGTTCC
TTACCAGCCTCCCTTTCTCTGTCAGTGGGGACGTCATCAGCCAAGCTGGAAGCCATTAAT
GAACTAATTCGTTTTGACCACATATATACCAAGCCCCTAGTCTTAGAGATACCCTCTGAG
ACAGAGAGCCAAGCTAATGTGGTAGTGAAAATCGAGGAAGCACCTCTCAGCCCCTCAGAG
AATGATCACCCTGAATTCATTGTCTCAGTGAAGGAAGAACCTGTAGAAGATGACCTCGTT
CCGGAGCTGGGTATCTCAAATCTGCTTTCATCCAGCCACTGCCCAAAGCCATCTTCCTGC
CTACTGGATGCTTACAGTGACTGTGGATACGGGGGTTCCCTTTCCCCATTCAGTGACATG
TCCTCTCTGCTTGGTGTAAACCATTCTTGGGAGGACACTTTTGCCAATGAACTCTTTCCC
CAGCTGATTAGTGTCTAA
ggaatgatccaatactgttgcccttttccttgactattacactgcctggaggatagcaga
gaagcctgtctgtacttcattcaaaaagccaaaatagagagtatacagtcctagagaatt
cctctatttgttcagatctcatagatgacccccaggtattgtcttttgacatccagcagt

--------------------------------------------------------------------------------