--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (28143 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (19 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       7235       7338   0    Initial    104   100   Excellent
gcaggagtctaactttattttttttcacagcagatttcccagttgtctcaatacgagtct
tttttttcttttttaatacggtgctatgtttataaacatcagtgctacatttataatgac
tgaaaaaacaaaaagggttcatgtggttttcttttacttggctagcaggtattgaatgtc
ATGTGTCAGGCACAGAAAGCTGTTGCAAAGACCAACAGTGATTCAGACACAAAGCCCATC
GTGTCCTATTTTGGGGGTGAAGTAGTCGCTGATGATGGCATGAT
gtgagtgggttggaatggagacctagcccaagagctgtgggcacaggagggctgacttac
cctgccagtggtgttgggagacttgagctgggcctgtgggccatccagctgcatcctcca
ggcctggcggagctttctctcaggcagggaagcgcaggcacagaggcttcaagtgcgtgt

Exon  2 +       8169       8215   1   Terminal     47    77        Good
tgacctggtagttttttcttgtttttaatctcagatgtcttcaagtttccctaattccct
aatttttcttcttcttgcctcaggttggtcttgttttttctttgttaaagtgattttcct
tgtagtggtgtaggttctattgacagcattgctatcctgagtgtcttttcttctctttag
GAGTCAGCATTGGTAATAGTGCTGTGCTGCGGAAGAGTGGAGTCTAA
actttttcattgccagtgccccgaaactggagtgtgaaggaccgagacaaaatgaagact
gtgctcatggttgctgaaaagccgtccttggcacagtcaattgccaaaatcctctctaga
ggtaggagagaccagccctgctttggtctgtaagcacggtcgtttatgtgttacaggaca

Exon  3 +       8232       8336   1   Internal    105    82        Good
ttttcttcttcttgcctcaggttggtcttgttttttctttgttaaagtgattttccttgt
agtggtgtaggttctattgacagcattgctatcctgagtgtcttttcttctctttaggag
tcagcattggtaatagtgctgtgctgcggaagagtggagtctaaactttttcattgccag
TGCCCCGAAACTGGAGTGTGAAGGACCGAGACAAAATGAAGACTGTGCTCATGGTTGCTG
AAAAGCCGTCCTTGGCACAGTCAATTGCCAAAATCCTCTCTAGAG
gtaggagagaccagccctgctttggtctgtaagcacggtcgtttatgtgttacaggacat
tttttcctaatgtgattccaccctggctggggtagatttggttcgggtcggcaggtggta
atgaagcatctcagtatgtcacagtggggtgcatttgcttccactcctggcaatgtgcca

Exon  4 +       9488       9648   1   Terminal    161    57    Marginal
cctgagcgccgtcccacctctcagtgcccaactacccgcaccagtctgcggaatgtcgtc
actcaccactctggggaaggaggactctggccctctgggaggtggcatccgggctggggt
ctccacagggtcttcagctcagctgaagcagccagtcactttgtgcttcctcatccccag
GGAGCCTGTCCTCACACAAAGGGCTGAACGGGGCCTGCTCAGTCCACGAGTACACTGGGA
CCTTTGCTGGCCAGCCAGTGCGCTTCAAGATGACGTCTGTCTGTGGTCACGTGATGACCC
TGGATTTCCTGGGTAAGCCCCTCTACCCTCCATCCTACTGA
agggagttctgcatggcactggccagggtccagttgaagccaggagatgcctctaggcag
ggaagtttgtcccaactccatgagtcataaggccagcagatcatgaagtagcaatgagag
ggtccctggtgcggtgcccagaacccaggctctggaactcagccctgggtccccatcata

Exon  5 +      11258      11364   1   Internal    107    92   Excellent
gttaccaaaggcctgaacccacatcctggctctgcctctgatcatcaggatgaccctggg
caaattgttctccaagctttcccctcctcatttgtgggatgaggccaacatcctcctggg
gttatgatggtctcggaggctgagctcctgtgactcaatgtcactgtgactggtttgtag
GAAAATACAACAAATGGGACAAAGTGGACCCCGCAGAACTGTTCAGCCAAGCTCCCACGG
AGAAGAAAGAAGCTAACCCCAAGCTGAACATGGTGAAGTTCCTGCAG
gtgcgtggggctggcctgggcatgagcacaccggggctccccaccctccacagctgccat
gtctttgcccacccttgcttgagtcctaatcccccttggacaggggggcctttgctagct
ttttctgtgagtgccccctgctggcccacgaggcacctgcaggcacccccaacacacaag

Exon  6 +      12025      12099   0   Internal     75    79        Good
attcttttctgttggctgagccagcctcaacacagccagctccttacccagcccaggtac
cagtcctcctaactgaggttcagggcctgggaccaagccctgtcctggatgggagcactg
ggggcgggtggcacagaccgggtctgcagcaggtacgtgtgaacctgtgctgtgtggcag
GTGGAGGGCAGAGGCTGCGACTACATCGTGCTGTGGCTGGACTGCGACAAGGAGGGGGAG
AACATCTGCTTTGAG
gtgagtgtgaggctcactttgttcctcacttttggcctttctgacaccagccccaaactg
acaccagcagtcagtcacatcactcctggggccaaaggagggagtaaactgtaccggttt
aaaaacacctctcccctccctttattctgaaactccacagatacttttaactgcataggc

Exon  7 +      13570      13716   0   Internal    147    97   Excellent
agggggatagaggagggtctggcaggtgcaggaaaggggatagaggagggtctggcaggg
gcaggagagggagccgagcacacgtgttctttcctggaaggaaccaggcttcacagtggg
gtggggagctgtggcagggatctgggaggtgggtcacagctggccactccccacccccag
GTTCTTGATGCTGTTCTGCCCGTCATGAACAAGGCCCATGGTGGCGAGAAGACCGTGTTC
CGGGCCAGGTTTAGCTCCATCACGGACACAGACATCTGTAATGCCATGGCCTGCCTAGGC
GAGCCTGACCACAACGAGGCGCTCTCA
gtggatgctcgccaggagctggacctgcgaatcggctgtgcattcaccaggtgctggcca
cacccgcagagtcctgggcacaccctcactctccctcagccagagacctgcctctactgg
tccccctccggggcccctaggcctcctcgagccaggatgagcaacaggggatttcaccaa

Exon  8 +      16260      16373   0   Internal    114    78        Good
agagggccagatgtcagcttgcgtatctgcccacctgaacaggtacagctgtgagccatt
acagccagggctatttggctcccagacaaggaccagcttcatctgtcctggttcttcctg
gcgttgggctcacctggagactttttcttgtgcgttcaccctttatcctttttcctgcag
GTTAACACTGACAAAGACAGATCTCTCCTTTTGGACTGGGACCGAGTAAGAGTGTTTGAC
CGGGAGATCGCACAGATGTTTTTAAACATGACAAAGCTGGAGAAGGAAGCCCAG
gtgtgcctgctccacccacatctatcacagttgccttgggtgagggtggcccttggatgc
ctcccgctggaggaacagcctgtgatcctagtccacgtctttctccccctttctgaaaca
cagacatctttttggaaagctgaatggttactccctcatatactcctaagatatttctgc

Exon  9 +      18601      18691   0   Internal     91    85        Good
tctttttcctttcctggtcctgaataaatattcaatcaagtctttagactgttgggaaga
atgaattggagaaacagggagaccagatgaatgaaaccagacccttcgtccacacatctt
gattccctctatggtggtgtcttcctccttccccaaatcattgactgtcctgtcttccag
GTGGAGGCCACAAGCAGGAAAGAAAAGGCCAAGCAGAGGCCCCTGGCCCTGAACACTGTG
GAGATGCTGCGTGTGGCCAGCTCTTCTCTGG
gtatgtagggacatttctctcaagtcaccagaaggcttcctgaggcaggttcagcctgga
gcagcgagtgcccagggttgcaggatggtgcccaaggcttcaaggggatctgagcctcag
gaggatttcacttatccttaggttgtaaaggtggtaaagttggtcaccacctgaggggac

Exon 10 +      19661      19843   1   Internal    183   100   Excellent
actgtgtggcataggtgcccacccggccagcagctttgcactccagctgtgcctgctcag
agccaccgtcaccctccaggaggggccggccacaatgggggagcctgagtgcataggcca
gggcaggcagctggccatccccacgtacctggccctctgagaacctcctgtctctcgcag
GCATGGGGCCGCAGCACGCCATGCAGACGGCTGAGCGGCTCTACACGCAAGGCTACATCA
GCTACCCACGGACAGAGACCACCCACTACCCTGAGAACTTTGACCTGAAGGGCTCTCTGC
GGCAGCAGGCCAACCACCCCTACTGGGCCGACACGGTGAGTGGAGCCGGGCCGGCCTCAG
CAT
gtgtgtgtgtcactgaggccttgggaccaggtctggtacgtcagccaaacccaggcaggc
agccgagcccagccacagactctgctctgtcttctctccctcaggtgaagcggttgttag
cagaaggtatcaaccgcccgcggaaaggccatgacgccggcgaccatccccccatcaccc

Exon 11 +      19948      20053   0   Internal    106    94   Excellent
aagggctctctgcggcagcaggccaaccacccctactgggccgacacggtgagtggagcc
gggccggcctcagcatgtgtgtgtgtcactgaggccttgggaccaggtctggtacgtcag
ccaaacccaggcaggcagccgagcccagccacagactctgctctgtcttctctccctcag
GTGAAGCGGTTGTTAGCAGAAGGTATCAACCGCCCGCGGAAAGGCCATGACGCCGGCGAC
CATCCCCCCATCACCCCCATGAAGTCTGCCACAGAGGCCGAATTAG
gtaccgctctcatcccatacccggtgtgcttccagggagggaagggcgagctgcgacagt
gaaggttgcaggccctgttggcaatgtgggggctccttcagcctctgcctgccctggctg
tggggatggggggccacctggaagatgagctccattgctatgggaccaggacaggagtga

Exon 12 +      21083      21291   1   Internal    209    96   Excellent
gcatgagccaccacgcccggccttcctgcacattttctttcctccttccccaggatttgc
agtgtgtcctgcacagcggctctgtaagcaggagcttgctgctcgagcgagagtactggg
ggctcctcacggccagagcccccagctggctcccaactgactagccctggcctgttgcag
GGGGTGACGCGTGGCGGCTCTATGAGTACATCACCAGACACTTCATCGCCACGGTCAGCC
ATGACTGCAAGTACCTGCAGAGCACCATCTCCTTCAGAATTGGGCCCGAGCTCTTCACCT
GCTCCGGGAAGACCGTCCTCTCACCAGGTCACACCACGGGCCCAGCCTTCCTCCTCTGTG
CCTTCATGGGCAGACAAACATTCTACATC
gtgtctggggatgggaggcccagggtctgaggccccggccacccaggctggggaccctga
gtggcggcgcatatctctccaggcttcacggaggtcatgccctggcagagcgtgcccctg
gaggagagcctgcccacttgccagcggggtgatgccttccctgtgggcgaggtgaagatg

Exon 13 +      21400      21547   0   Internal    148   100   Excellent
ctctcaccaggtcacaccacgggcccagccttcctcctctgtgccttcatgggcagacaa
acattctacatcgtgtctggggatgggaggcccagggtctgaggccccggccacccaggc
tggggaccctgagtggcggcgcatatctctccaggcttcacggaggtcatgccctggcag
AGCGTGCCCCTGGAGGAGAGCCTGCCCACTTGCCAGCGGGGTGATGCCTTCCCTGTGGGC
GAGGTGAAGATGCTGGAGAAGCAGACGAACCCACCCGACTACCTGACGGAGGCCGAGCTC
ATCACGCTCATGGAGAAGCATGGCATCG
gtgggtgcgcctgcccaggccccagagccggctccgtctccagtactcaggcttcgagtc
tactcacaaagctgccccgccagccctgtgtgcccagcccagcacccctccatgggctgg
tatctggaaactggtgacccagtgtgtggccagccaggcaggtccacagcgggcatcccc

Exon 14 +      23527      23655   1   Internal    129   100   Excellent
aatgcatgcagttggtgcccagcacagtgcagggggagctcagggcacagccctccctcc
tgtgaccgggagcagtgagagggcctgagcaccaggggccccgtgacaggtgatacagca
catggttcagtggggcatgtccaaggcaggccaggaaccctggggccttgtacattgcag
GCACGGATGCCAGCATCCCTGTGCATATCAACAACATCTGCCAGCGCAACTATGTCACGG
TGGAGAGCGGGCGCCGGCTCAAGCCCACCAACCTCGGCATCGTCCTGGTGCACGGCTACT
ATAAGATTG
gtgagttcctcagtcctgcccccagggcccaccgaggctccctggcttctccctggatgt
tggctctgctgcccgctccagacaggcccctgccctacagtgatcccccagccccacaca
cactccctcaacacccgctgaaggggtgctgccccaggacccccaggacctgcccagagc

Exon 15 +      24240      24394   1   Internal    155   100   Excellent
tctggggtcataagagccagcctggtaccatctgaggctgtggactggtgggtagggcag
aggccaggaggacgggccagagcgggaggggtgaacagggcagtatccctgcctgggaag
gggtggcatggccctgggtgcgagtgctcagggcaatatctgccccctgcccacttgcag
ATGCAGAGCTGGTGCTCCCCACCATCCGCAGTGCAGTGGAGAAGCAGCTGAACCTGATCG
CCCAGGGCAAGGCCGACTACCGCCAGGTCCTGGGCCACACCCTGGACGTGTTCAAGAGGA
AGTTCCACTACTTTGTCGACTCCATTGCTGGTAGA
gtctgcctctggcctgcccctcaccagaggggtgtctctctgtcagcaaggccagtacct
ggggacccaggtccccacgtgggaccagctcccagatctgggcttcaggcctccgtaggc
caggtcagtgacacctcctggctgggttgaaagagcaggtgcattaacaccacacatggc

Exon 16 +      25283      25484   0   Internal    202   100   Excellent
ttttagaactgccttttctgcacgcgtggagcaagagccagagactcatgctccttgcct
ggcagtgtgtcacaggttctgcatgacagattacatactttgtattatgagaggagtggg
ggtgggtgccaagtcggtggccccagtgaccctcacgccacctgcctggcattgccgcag
GCCAAGCCAAGCCGCCTGCACTGCTCCCACTGCGATGAGACCTACACGCTCCCCCAGAAC
GGCACCATCAAGCTCTACAAGGAGCTCCGCTGCCCTCTGGATGACTTCGAGCTGGTCCTG
TGGTCATCAGGCTCTCGGGGCAAGAGCTACCCGCTGTGCCCCTACTGCTACAACCACCCA
CCCTTCCGAGACATGAAGAAAG
gtgagtgcagccactccctcctgtccacaggtagctgcagtctcttttcagtgccaaccc
ctgccttgcaccaggctggactctgaggggacccctcaccctggcctttcctgcactcat
tggcactgagacgagagaccctggatgtagctggggcactgcttaggcctcagccagtgg

Exon 17 +      26234      26334   0    Initial    101    43    Marginal
gttccatgtggcccagtgacatgagggtcatgtggcattaccagtaacaagctggcagca
aagcaaaggggggatggagtcagctgaaacccactgggatggtgccagcgaggggccttg
aaagttgaggaggtttcaggtaagcagaaaacaggggtaatggcagccaggagccgaaac
ATGAGCAAGGCTGTCCCCAAGAGCAAGGCCAAGAAGAGTTCCTTCTGCTGGGACGAGGGA
TCCAGGAGCTTGAGGCATTGGGAGCAGGCAGCAGAGGGCAG
gtgggcacagtgggcgtgcctttacagggctcccttctcccgccaggcatgggctgcaac
gagtgtacgcacccctcctgccagcactcgctgagcatgctgggcatcggccagtgcgtg
gaatgtgagagcggggtgctggtgctggaccccacctcgggccccaagtggaaggtggcc

Exon 18 +      26381      26746   1   Internal    366    90   Excellent
aaaacaggggtaatggcagccaggagccgaaacatgagcaaggctgtccccaagagcaag
gccaagaagagttccttctgctgggacgagggatccaggagcttgaggcattgggagcag
gcagcagagggcaggtgggcacagtgggcgtgcctttacagggctcccttctcccgccag
GCATGGGCTGCAACGAGTGTACGCACCCCTCCTGCCAGCACTCGCTGAGCATGCTGGGCA
TCGGCCAGTGCGTGGAATGTGAGAGCGGGGTGCTGGTGCTGGACCCCACCTCGGGCCCCA
AGTGGAAGGTGGCCTGCAACAAGTGCAACGTGGTAGCGCACTGCTTCGAGAACGCCCACC
GCGTGCGGGTGTCCGCCGACACCTGCAGTGTCTGTGAGGCCGCCTTGCTTGATGTGGACT
TCAACAAGGCCAAGTCCCCACTCCCGGGCGATGAGACGCAGCACATGGGCTGCGTCTTTT
GTGACCCCGTCTTCCAGGAGCTGGTGGAGCTGAAGCATGCGGCCTCCTGCCACCCCATGC
ACCGCG
gtggaccagggagaaggcagggtcgagggcggggccgggccaggaggccccctgggaagc
ccaaccccagacggcccaaggacaagatgtcagccctggccgcctactttgtatgatgac
cctgtcctccctcacccaggctgcagtgccatgcagacacctcatggcacttcaaactat

Exon 19 +      27075      27281   1   Internal    207    51    Marginal
ccatgcagacacctcatggcacttcaaactattaaaatgcattttatcttatccagagct
ggggcccctttgctggtgcagcgatgtcagagcgttaccgtgtccctgggcacctgtggg
gccctctctccctctccgaaacccaatacgtctcccttcagcctgcatacacgtgcccag
AGTGCTCCCTGCTATCCCTACACCCTGGCAGTACGGGCAGGGATGCCCCAACCCTGAAGC
CCTGGGGAATAGACCCAGTTTGCACTCACACCCCATCTCAATCCGTGCTGCTGATGGTAG
CTGTGTGCACAAGCAGTGGCCCTGATGCCTTAAGGAAGGCGGCCTTGACAGCTGTGGCTC
CGGCAGGAGAGGAGTCTAGTGGAGCAG
gtggggctgggagaccccctccccggatctggcttatgaatccccttggtcttcgctgca
gccccctgctcagggccacgctcttgaccccacacttctccgtcccctgctccctgctcc
catctctgagaagccctgtacatggtgcccgtgtgcgtctggcagcttcccaggacctgc

--------------------------------------------------------------------------------