--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (29290 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4027       4175   2   Internal    149    64    Marginal
gccataatcctctgggccaggggcccctggcagtgagtggcaccacaggcccccgccccc
ggactccgtgggctgggctgggctgggcgcggtgcggctgggcacacgcagtcggaggcg
gcgccggccaggccgccgggcgcctatggacgcgcggagcccgctgtctccccgagccag
TGCGTTCAGCATCGCCTCTCTGGTTGCAGCGGAGGCGGCGGAGCGCACCGCCCACCAGGG
CTCAGGGTCCTCCGACCGGGTGAAGCTTCGCTGGCTGCCAGGATCCCCGGCAGGGATGCA
CTTCAGCACCGTCACCAGGGACATGGAAG
gtgagcctccaggccgtgtctacactggcccgcccgccagaccccctgcctcagctgctg
tggggcccgggtgcaaagtaggtggaggcagctcttggtagcgtgggctccaggcttctg
gctgcgattctggggcagagaggaagagccggcatcccgcccacagcctgtcccctcacc

Exon  2 +       5362       5778   2   Internal    417    59    Marginal
ggggccccgggcggggcggggcggggcgcctcctcggggccggcctgcggtgtggggctg
cacggcccggggcgcacgcagcgcggcgcccgccactcggcccgcggcgcggggcagcgc
tcagcttggtggcgggggcggcggcggcggcccgcgggtcatgatctccgccgtgtccag
CCCGTGGCTCACGCAGCTCTCGCATTTCTGCGACGTTGCAGCCTTCACGGCCAGCAGCCT
GAGCAGCCTGGGGGCCGCGGGGGGCTTCCCGGGCGCCGCGTCGCCCGGCGCCGACCCGTA
CGGCCCGCGCGAGCCCCCGCCGCCGCCGCCGCGCTACGACCCGTGCGCCGCCGCCGCCCC
CGGCGCCCCGGGCCCGCCGCCGCCGCCGCACGCCTACCCGTTTGCGCCGGCCGCCGGGGC
CGCCACCAGCGCCGCCGCCGAGCCCGAGGGCCCCGGGGCCAGCTGCGCGGCCGCAGCCAA
GGCGCCGGTGAAGAAGAACGCGAAGGTGGCCGGTGTGAGCGTGCAGCTAGAGATGAAGGC
GCTGTGGGACGAGTTCAACCAGCTGGGCACCGAGATGATCGTCACCAAGGCCGGCAG
gtcagggcgcccctccccacgccgcgaccctccccacgtgctgccgccagggctgcgggc
ctccgcctgatccgcgcgagcggggccgaaagccgggtcgggggcgcggcctggccacct
gcgggcccctctgggccccgctgcctccttcgctgttcgccgtcccggctccggcgacag

Exon  3 +       7739       7840   2   Internal    102    98   Excellent
gtaggggcctgcccagattagagcagctaagccaggaaagatggagcccaagggctggga
cgacacagcagcccccagaggctggagggaggggccgagcagaggggccgccagccccag
gcaggtcaaggggggctgccttccaccagctagggtgacccaaggcctcatcacccccag
GCGGATGTTTCCCACCTTCCAAGTGAAGCTCTTCGGCATGGATCCCATGGCCGACTATAT
GCTGCTCATGGACTTCGTGCCGGTGGACGATAAGCGCTACCG
gtgagcgagtggttgtaagcgtgagggaccgggagggcaccctggaaagtggcgggtctc
cgcctggtgacccaactccaagggtcgtctgcaccatgaaactctttaggcacctgcgat
gctgcccgatcaacccgctccctcctccactcccatctgaccccagacccacaaccctac

Exon  4 +       8192       8223   2   Internal     32    58    Marginal
caaccctactccatgccctctcagaacccgcctctggagccgcaggctgcagacagctct
tgctcccctgggctggtgtggccctagggtggtcagccaagtactcagccccggacttct
tcaagtctccctctcccaggaggccggcctgagcgcctagtccccttcccccatccccag
GGAACTCTGGATCCTGGAGCTGGGCCGGAAAG
gtggggtggccaggagagattatgcagggcgggcctcagctgcccggacaattaacagca
attaataaagagaacgcgcactgccctgtgcctgaggcccggcaaggccaagtgtgggct
cccaccgcagcggcaccggggcgggaggacccgcatccagcgaaatgagatggcaggagc

Exon  5 +       8653       8824   2   Internal    172    98   Excellent
ggagttctctgtttagtccatagtcccccttggaaaagctcccagcacatgcggcagcag
agggttcaatctcacaggtggggaaacttctcaaaggcacttttagggttcgcccagcac
acgggtcaaggccctctgggttcacctccacatgcacgaccccaccccgtgccgctccag
GTACGCCTTCCACAGCTCCTCCTGGCTGGTGGCGGGGAAGGCCGACCCTGCCACGCCAGG
CCGCGTGCACTACCACCCGGACTCGCCTGCCAAGGGCGCGCAGTGGATGAAGCAAATCGT
GTCCTTCGACAAGCTCAAGCTGACCAACAACCTACTGGACGACAACGGCCAC
gtgagcgactgcctccccaggctccggtgtcccccaaggcctcgagtcccgaggcacccg
cctgtccctaagaggcctgtagaatccccaggcccccggctgtccccaggcggctctggg
ctgtccccgaggaggccctttagagtccctgcgaggctagaggctgaggcggagcttggg

Exon  6 +       9405       9665   0   Internal    261    91   Excellent
agagaacctaaacccagatcttttgccacttggagctcattcctggcagttgccaatggg
tcacagcctcctcttggcccagtgacccagcctcatcttggaattaagggttttgcccaa
ctcatccaggaaactcattgccaactcagacctcagcccatttcctggctcccaccccag
ATCCTCAGCCCAGCCCCACCGCTGGAGCTGATTCCCCACCTTGTCTTCCAGATTATTCTG
AATTCCATGCACAGATACCAGCCCCGCTTCCACGTGGTCTATGTGGACCCACGCAAAGAT
AGCGAGAAATATGCCGAGGAGAACTTCAAAACCTTTGTGTTCGAGGAGACACGATTCACC
GCGGTCACTGCCTACCAGAACCATCGGGTGAGGGCCTGTGGGGAGGACCTGAGCGGATTC
AACGCCTCTGGAAAAGCGGGT
gtaattttcagttgccgtttggggacagtgggtccgcttagacctgcaggctgtggtccc
agtggagcccaacccaactggagccccactcccaagggcctcaggcagccccctccctct
cgaggctggccggcccagcctcctatcagcttgacctctccagcggcaactgtcacttcg

Exon  7 +      10256      10323   0   Internal     68    97   Excellent
ccgcccccctgcaggagggagcaccagctccgtagaggaggggcagacgtggactggttc
ttgtcagggcagcagaaaggcccttggtgcgcttctcctaacactcccctatcctccgcc
gaggtcgggtggcccaggctgcagggctccagcggcttgctcacacccacctccctgcag
ATCACGCAGCTCAAGATTGCCAGCAATCCCTTCGCGAAAGGCTTCCGGGACTGTGACCCT
GAGGACTG
gtgagtgtcctcccccgagagagtgagcgccgggcgcctggcgcaggcgccgccctgatc
cgcctcccgcccgcaggccccggaaccaccggcccggcgcactgccgctcatgagcgcct
tcgcgcgctcgcggaaccccgtggcttccccgacgcagcccagcggcacggagaaaggta

Exon  8 +      10400      10500   2   Internal    101   100   Excellent
ggctccagcggcttgctcacacccacctccctgcagatcacgcagctcaagattgccagc
aatcccttcgcgaaaggcttccgggactgtgaccctgaggactggtgagtgtcctccccc
gagagagtgagcgccgggcgcctggcgcaggcgccgccctgatccgcctcccgcccgcag
GCCCCGGAACCACCGGCCCGGCGCACTGCCGCTCATGAGCGCCTTCGCGCGCTCGCGGAA
CCCCGTGGCTTCCCCGACGCAGCCCAGCGGCACGGAGAAAG
gtagggccggggtcgtgggatccgggttccggccctgtgcgcgctctaccccgggccggc
ggcctcgcccgacctcgcctgcgcccccggggcgctccaggctttcgcgccggttgcaca
acggccgcggcggcgggcaagcgcgcactcgcccgcccggcccgacggctgcgccccgcc

Exon  9 +      10815      11251   1   Internal    437    59    Marginal
gggcaagcgcgcactcgcccgcccggcccgacggctgcgccccgcccgccgccgccgccg
cccgcagaggggcgcgggccccggggagggctcggggcgccggcgacttggggtctcggg
cacgctggcaccgactggtcggggaacaccgagggcggccaagagccttctctccgccag
GGCCTCGCATGGGGCGTCGGAGCTCCTCGGCGGCCCCGGCCGGCCGCGCTCACTCCTCGG
CCCTCTCCGCAGACGCGGCTGAGGCCCGGCGAGAATTCCAGCGCGACGCGGGCGGGCCAG
CAGTGCTCGGGGACCCGGCGCATCCTCCGCAGCTGCTGGCCCGGGTGCTAAGCCCCTCGC
TGCCCGGGGCCGGCGGCGCCGGCGGCTTAGTCCCGCTGCCCGGCGCGCCCGGAGGCCGGC
CCAGTCCCCCGAACCCCGAGCTGCGCCTGGAGGCGCCCGGCGCATCGGAGCCGCTGCACC
ACCACCCCTACAAATATCCGGCCGCCGCCTACGACCACTATCTCGGGGCCAAGAGCCGGC
CGGCGCCCTACCCGCTGCCCGGCCTGCGTGGCCACGGCTACCACCCGCACGCGCATCCGC
ACCACCACCACCACCCC
gtgagtccagccgccgcggccgccgccgccgctgccgcagctgccgcggccgccaacatg
tactcgtcggccggagccgcgccgcccggctcctacgactattgccccagataacacggg
ccctgtcgcgctcccgccccggtcctgcacagccccgaagttcgccgggcccggccaccc

Exon 10 +      15872      15980   0   Internal    109    58    Marginal
tggccaaggagcaggtgggggcacggccccccagcctggcatagtggcacccaagcctag
ggagggcaggatgagacctttttccttggtgctacctcacacattttctggatttcaaaa
aacacaactggtgcctttgattcaattccctttcctgcttgttgtactacttcaaaccag
ATGGGCTCCTCAGATGAAACTCCGGAGACTCAGTGTCTCTCTTTAACCGCTGCCAGGTCT
GTGTGTGGGAAACAGCAGAACCAGAAATATTTTGCTAAAACCAGCCCAT
gtgggggagaggcttagcttttaatagcagtaattaaattatcttcttaattataaaggg
tgatggcattgtcaacatgctttatctatcagctttcaattgcacaaagtaagcacgtaa
tcctctcctcccggccccactggcatcctctgctctgtggccagcccaggcccccttcct

Exon 11 +      23718      23888   1   Internal    171    81        Good
gtggaggccgtgtctgtgtctgtgtcctgtgggcggctcggctcgttgggagatgcagtc
ctgtcctgcccttccatgcggttcagacactggacatttgtgcagtctgatctgcaagaa
aagagaggcacctctgacatggtacttcatccactctcattggatggggttgtcacccag
GTGGACATGTCCTGAAGGACAAGGAAGTGAAAGCTGAGACGTCTAGGAACACACCAGAGA
GAGAAGTGGAGCTTCTGAGGGATGCAGGTGGCTGTGTGAACCTGGGGCTCCCCTGCCCCG
CAGAGTGCCAACCCTTCAATACCCAGGGCCTGGTGGCTGGGAGGACCGCAG
gtgaccgtctttgttgaatgctgaggccgggccatgggcacatggagttgtcgtgtttcc
cttcactttggttcatgtttgaaatttccaaaattaaaaaaacagtgacttgttcagtaa
attccaatatgaataaagtgcatgttttgtaataaatacttctccatagagtcacactcc

Exon 12 +      27411      27473   1   Internal     63   100   Excellent
gtgaggctgatgtgcatggattctagctccttccctgtttctggggcctcagctgtctgt
gttcactctttcttgctacacaaagagaaacaaggacaagccttatttgataaaggccac
aaacactttgaccttcctccacccagtgtagggatctgtttcccctctcctggactccag
GGCTGGTCACAGAAGGCTCTGGGCTCCAACCTGGCTTGCTGGACGTGCTCTTGAAGCCCC
CAA
gtaagaagtctgagtccctgagaccaccacactgcaaggacacttgaaggtactcaggtt
ggtggtccccgctgtgcccagcccctgaatgaagccaaggctccaagcacctgagtgaag
aggctgtgatggaagcgaatcctccagccctggccatcaccccgtggagtagacaaactg

Exon 13 +      28130      28231   2   Internal    102    51    Marginal
aggcaggaggatcacttgagcctattagttggaggctgcagtaagctatgatcatgccac
tgcactccagcctgggtgacagagtgagacccccactgtccctggtctcttaaaagaaaa
aacaaacaaacaaaccaaaaaacaaaacagcttatgagcacctcctactaatttcctcag
CTTAGCACACCCTGTGGCCGTTGTCCCCATCGTCCGTGGCTTCATCCCTCAACTGATGCT
TTCCTATGTGGACTTCCCGGCCAGTGCTGTGGGACCTCCCCT
gtagggctggccagcctcatgggctgggctacccgtcccactcagcagtggctgcctggc
ctcccctctgtccctcctgcccagctcctaatgggcctcccataaaagctgatgcgtggg
agccaagccacagctcgctgacctggggaagctgacagagtgacagagggtctcaaggac

--------------------------------------------------------------------------------