--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (30628 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (40 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1396       1450   0    Initial     55    87        Good
ctgggaagatggcggcgggaacctgggccgccgccgccgccgccgccgccgccgcggagc
gaaccaggggtgtccggggtgcgcggtccagggccggggccgggccatgagcgcgccgtc
ctcgagtccccgagccgcggagcccgcccgcgcccctcgggccgccccgcgtccctcgcc
ATGGCGCGGCTCGCGGACTACTTCGTGCTGGTGGCGTTCGGGCCGCACCCGCGCG
gtgagtgccgaggccaagcgctgagggccgggggccgagggtcgagtgctgagggccagg
ggctgggtctgagggtcgagggccgggggctgggggccgagggctgggggctgggtcggg
aggccgaggactgagggccgggcgctgagggccgaggaccgggggctgggcgctgagggc

Exon  2 +       6520       6561   0    Initial     42    66    Marginal
ctctgcccctgtaaccctggagggcagatggtctccccgcctgtaggggacccgtggagt
gtgtgccattgggctgccagagttgctcatctgttcccaggaggaccaggcatgctggat
gtggggctgcagcttcttgggggccggggtggggggtccatgaggggctctgtgttgagc
ATGACCCCCGCCTTGCCCATCTGGCTCTGCTGCTTCCGCCAG
gtgggtggcggtgtagaggcccgtccagacagaggatgggccctggggacctgcggtttg
tgtggaggagaaggcaggcaggctttcgtctttcctgctgcacctgctccatcctccaca
agccctgggaggcctgcggagccgtcctgctgcgggagccacaccctgagtgtcccactg

Exon  3 +       7775       7907   1   Internal    133   100   Excellent
ggccctggggtctgcagctgtcaagcagactctccatacggagctatttttagggagctg
tggctgatctggtgccagatgagggcccagtgggtgggaatgtttccaccctgggatcct
caagcctcctggtgggtggggggcgggttgggtgctctgaccccctgttcttgtcctcag
GGAGTGGGGAAGGCCAGGGCCAGATTCTGCAGCGCTTCCCAGAGAAGGACTGGGAGGACA
ACCCATTCCCCCAGGGCATCGAGCTGGTGAGTTGGGGGCGTGCTGAGACGGTGCTGGCAG
GTGGGGAGGGCAG
gtgggcacagccctgcccttgtccctgactgaggggcctccacagtgcccggccccccgc
tgggctagggacaagacagcagagcctctgtcggggggtttgaccggcttggccggcggc
ctgtgcggtgctcatgtcactgtgtcatgttgtcactcactcatgatggtggggactgtt

Exon  4 +       8327       8450   2   Internal    124    54    Marginal
cggagagactgaggcccaggaggccacgtgtccccagggtctccaagcaaggagctgcct
gtgtgtgttggagcctccaggcctggtggtgcagatgctggggcgggtgggctggttcct
gccacaggtgtagggggaggagctgactgctgagccttccctgcagttttgccagcccag
CGGGTGGCAGCTGTGTCCCGAGAGGAATCCACCGACCTTCTTTGTTGCTGTCCTCACCGA
CATCAACTCCGAGCGCCACTACTGCGCCTGCTTGACCTTCTGGGAGCCAGCGGAGCCTTC
ACAG
gtcagcttggggcctctgggtacagcatgaatgaagctgcatccttgggccgtggccaac
tccccctgcccccgtctccccctgacccccagcaggaaacgacgcgcgtggaggatgcca
cagagagggaggaagagggggatgagggaggccagacccacctgtctcccacagcacctg

Exon  5 +       8645       8704   0   Internal     60    76        Good
tctgggtacagcatgaatgaagctgcatccttgggccgtggccaactccccctgcccccg
tctccccctgacccccagcaggaaacgacgcgcgtggaggatgccacagagagggaggaa
gagggggatgagggaggccagacccacctgtctcccacagcacctgccccatctgcccag
CTGTTTGCACCGAAGACGCTGGTACTGGTGTCGCGACTCGACCACACGGAGGTGTTCAGG

gtgaggccggcagccggggcggcgaggcacgacgagggtgcttccatcggctgtcccacc
actccccgctctggtcattgcagaacagccttggcctcatctatgccatccacgtggagg
gcctgaatgtgtgcctggagaacgtgattgggaacctgctgacgtgcactgtgcccctgg

Exon  6 +       8788       8898   0   Internal    111    99   Excellent
ccacctgtctcccacagcacctgccccatctgcccagctgtttgcaccgaagacgctggt
actggtgtcgcgactcgaccacacggaggtgttcagggtgaggccggcagccggggcggc
gaggcacgacgagggtgcttccatcggctgtcccaccactccccgctctggtcattgcag
AACAGCCTTGGCCTCATCTATGCCATCCACGTGGAGGGCCTGAATGTGTGCCTGGAGAAC
GTGATTGGGAACCTGCTGACGTGCACTGTGCCCCTGGCTGGGGGCTCGCAG
gtgagttttggaggcagctggtatctgcacagccacaggccctcctgctggggccctggt
aggtatttggagcccagccagagccacacacagctggaggccttggatgctccctcttgc
gtcctcgtgccaccattgcccccaacagtcctggcctgcttacctggccctcgcacctgt

Exon  7 +       9526       9631   0   Internal    106   100   Excellent
cagctgcttgggacaacagaggcagggcatggcgtttccctcttgccatgttgcccatcc
cagccagtcccacctcgggtctgtcagtacaccagggtctgcctggggacacagagctct
gggctgactctgggctggctctggccaaactactgagccccgatcctttttttgctgcag
AGGACGATCTCTTTGGGGGCTGGTGACCGGCAGGTCATCCAGACTCCACTGGCCGACTCG
CTGCCCGTCAGCCGCTGCAGCGTGGCCCTGCTCTTCCGCCAGCTAG
gtgagcctgtctgtcccacccccgcatggcttcccctcggggactggtagttagggatgt
gggttctcactctgcctgggtgggggcccagggtcctctccaagcttctcttcttccttt
aggcatcaccaacgtgctgtctttgttctgtgccgccctcacggagcacaaggttctctt

Exon  8 +       9754       9886   1   Internal    133   100   Excellent
ctggccgactcgctgcccgtcagccgctgcagcgtggccctgctcttccgccagctaggt
gagcctgtctgtcccacccccgcatggcttcccctcggggactggtagttagggatgtgg
gttctcactctgcctgggtgggggcccagggtcctctccaagcttctcttcttcctttag
GCATCACCAACGTGCTGTCTTTGTTCTGTGCCGCCCTCACGGAGCACAAGGTTCTCTTCC
TGTCCCGGAGCTACCAGCGGCTCGCCGATGCCTGTAGGGGCCTCCTGGCACTGCTGTTTC
CTCTCAGATACAG
gtgacccctgcccggccctcccagccccttctcctggcccctttgcccagccgcgtcccc
tggctcactgcatcctctggggcctgcacagcttcacctatgtgcccatcctgccggctc
agctgctggaggtcctcagcacacccacgcccttcatcattggggtcaacgcggccttcc

Exon  9 +       9978      10086   2   Internal    109    82        Good
cacaaggttctcttcctgtcccggagctaccagcggctcgccgatgcctgtaggggcctc
ctggcactgctgtttcctctcagatacaggtgacccctgcccggccctcccagccccttc
tcctggcccctttgcccagccgcgtcccctggctcactgcatcctctggggcctgcacag
CTTCACCTATGTGCCCATCCTGCCGGCTCAGCTGCTGGAGGTCCTCAGCACACCCACGCC
CTTCATCATTGGGGTCAACGCGGCCTTCCAGGCAGAGACCCAGGAGCTG
gtaagggctgtgctttgtgtccacctcacggcccaggcctgcaggtccctgactgccggc
tcccttggtccgcagctcgatgtgattgttgctgatctggatggagggacggtcaccatt
cctgagtgtgtgcacattccacccttgccagagccactgcagagtcagacgcacagtgtg

Exon 10 +      10908      11066   0   Internal    159    97   Excellent
aggagtgccttgtccagacagtttcagaggagctggtggccctgagtgcagaatggtggg
aggggcagaaggatgggagcggggcagcttggggtgggttggggtgtggagaagctcctg
ggcagcctggggtggggattggcaggactggctctcacctgcactcagctcttctcccag
GACAAGGAGCTGCGCGCGGTCTTCCTGCGGCTGTTCGCTCAGCTGCTGCAGGGCTATCGC
TGGTGCCTGCACGTCGTGCGCATCCACCCGGAGCCTGTCATCCGCTTCCATAAGGTGGGG
TGCCTGGTGGCTGGGCGTGGGGTAGGAGATAAGCGCATG
gtggagacccctgagggaccgacctccttctgtcatccaggcagccttcctgggccagcg
tgggctggtagaggacgatttcctgatgaaggtgctggagggcatggcctttgctggctt
tgtgtcagagcgtggggtcccataccgccctacggacctgttcgatgaggtgcacctcca

Exon 11 +      11319      11425   0   Internal    107    80        Good
ggacgatttcctgatgaaggtgctggagggcatggcctttgctggctttgtgtcagagcg
tggggtcccataccgccctacggacctgttcgatgaggtgcacctccaccctgccctccc
agccccctgccctggctccgcctgaccatggcttacctaacctcctgcttaccccgctag
CTGGTGGCCCACGAGGTGGCAAGGATGCGGGCGGATGAGAACCACCCCCAGCGTGTCCTG
CGTCACGTCCAGGAACTGGCAGAGCAGCTCTACAAGAACGTACGAGG
gtagcaggacgggagggcgtcgtaccgccttgatccctgggcccctgccccacacctgcc
gtctccccacaggagaacccgtacccagccgtggcgatgcacaaggtacagaggcccggt
gagagcagccacctgcgacgggtgccccgacccttcccccggctggatgagggcaccgtg

Exon 12 +      11498      11702   0   Internal    205    90   Excellent
gctggtggcccacgaggtggcaaggatgcgggcggatgagaaccacccccagcgtgtcct
gcgtcacgtccaggaactggcagagcagctctacaagaacgtacgagggtagcaggacgg
gagggcgtcgtaccgccttgatccctgggcccctgccccacacctgccgtctccccacag
GAGAACCCGTACCCAGCCGTGGCGATGCACAAGGTACAGAGGCCCGGTGAGAGCAGCCAC
CTGCGACGGGTGCCCCGACCCTTCCCCCGGCTGGATGAGGGCACCGTGCAGTGGATCGTG
GACCAGGCTGCAGCCAAGATGCAGGGTGCACCCCCAGCTGTGAAGGCCGAGAGGAGGACC
ACCGTGCCCTCAGGGCCCCCCATGA
gtgcgtaatgagggaggggaaggcaggccccgagcgtggcccaggatgggcgtggggtca
ggggtccgagtgtgtgtattctgtccccgcagctgccatactggagcggtgcagtgggct
gcatgtcaacagcgcccggcggctggaggttgtgcgcaactgcatctcctacgtgtttga

Exon 13 +      11795      11907   1   Internal    113    92   Excellent
gtggaccaggctgcagccaagatgcagggtgcacccccagctgtgaaggccgagaggagg
accaccgtgccctcagggccccccatgagtgcgtaatgagggaggggaaggcaggccccg
agcgtggcccaggatgggcgtggggtcaggggtccgagtgtgtgtattctgtccccgcag
CTGCCATACTGGAGCGGTGCAGTGGGCTGCATGTCAACAGCGCCCGGCGGCTGGAGGTTG
TGCGCAACTGCATCTCCTACGTGTTTGAGGGGAAAATGCTTGAGGCCAAGAAG
gtgagggctgtgcaggctccagccgggccagggcagcgggtttcagaggagacccaggct
gcacttcacccttgtgagtgctgacgctgccccagggcctcctctgcctaacagacagct
agaggtggctgggctggccggagggtaggtgggctccaggtctcctctcttgacctcagt

Exon 14 +      12804      13067   0   Internal    264    69    Marginal
cttgtggagttgtcgggcccactggaggttttagtctttattggtcggcaaagccccaga
gtctggcacaccccacctgaaaggcatttgggtctcctggacacctgctgccctccctgc
cagggccccgagtgggtcttctctgtgccctcagcccgtgtctcctttccccacccccag
CTGCTCCCAGCCGTGTTGAGGGCCCTGAAGGGGCGAGCTGCCCGCCGCTGCCTCGCCCAG
GAGCTGCACCTGCATGTGCAGCAGAACCGTGCGGTCCTGGACCACCAGCAGTTTGACTTT
GTCGTCCGTATGATGAACTGCTGCCTGCAGGTGAGGCCTCTTATCCTGCTAGTGACATGG
CTCATGGCGCATGAGCGGGAACAGGCGGGCAGACCCTGGTCTGTGAGTGAGAGTGGAGAG
ACGGTGCAAGAGACTCCTGTGCCA
gtgggcaggggtcctcggtctgcagggaacagggtggagagaaccattgttgggggcagg
tgctggggcctggggtctcctgatattgagcctctgaggcagccttggggagctggagcc
aagggtgtcaggtgctggtctgtggtggttatggggtggtgggggcatggtgggaggtga

Exon 15 +      13298      13366   0   Internal     69   100   Excellent
tgggggcaggtgctggggcctggggtctcctgatattgagcctctgaggcagccttgggg
agctggagccaagggtgtcaggtgctggtctgtggtggttatggggtggtgggggcatgg
tgggaggtgagtgctgcctgggaggggagaggtcctgacggtctctcgctctacctgcag
GACTGCACTTCTCTGGACGAGCATGGCATTGCGGCGGCTCTGCTGCCTCTGGTCACAGCC
TTCTGCCGG
gtgagtgctggcatggctgaggtctccttcccagcccccccttcctggtggctgaggtct
ccttcccagccccccttcctggtggccgaggtctccttcccagccgcccttcctggctgc
atccagctgaccttctcccctggctcctgcagaagctgagcccgggggtgacgcagtttg

Exon 16 +      13519      13677   0   Internal    159    98   Excellent
gctgcctctggtcacagccttctgccgggtgagtgctggcatggctgaggtctccttccc
agcccccccttcctggtggctgaggtctccttcccagccccccttcctggtggccgaggt
ctccttcccagccgcccttcctggctgcatccagctgaccttctcccctggctcctgcag
AAGCTGAGCCCGGGGGTGACGCAGTTTGCATACAGCTGTGTGCAGGAGCACGTGGTGTGG
AGCACGCCACAGTTCTGGGAGGCCATGTTCTATGGGGATGTGCAGACTCACATCCGGGCC
CTCTACCTGGAGCCCACGGAGGACCTGGCCCCCGCCCAG
gtgcgcagggactccctgggctgggggctgggggctaggggctggggcagcgtggccccg
gctcatgcgtgtggtgccgtggcaggaggttggggaggcaccttcccaggaggacgagcg
ctctgccctagacgtggcttctgagcagcggcgcttgtggccaactctgagtcgtgagaa

Exon 17 +      13862      14031   0   Internal    170    99   Excellent
gcagggactccctgggctgggggctgggggctaggggctggggcagcgtggccccggctc
atgcgtgtggtgccgtggcaggaggttggggaggcaccttcccaggaggacgagcgctct
gccctagacgtggcttctgagcagcggcgcttgtggccaactctgagtcgtgagaagcag
CAGGAGCTGGTGCAGAAGGAGGAGAGCACGGTGTTCAGCCAGGCCATCCACTATGCCAAC
CGCATGAGCTACCTCCTCCTGCCCCTGGACAGCAGCAAGAGCCGCCTACTTCGGGAGCGT
GCCGGGCTGGGCGACCTGGAGAGCGCCAGCAACAGCCTGGTCACCAACAG
gtgaggcagggactgggggttgggcccagtggaggcggggccgtggtgggcagggcccat
gcccacagtttcttctctggcccagcatggctggcagtgtggccgagagctatgacacgg
agagcggcttcgaggatgcagagacctgcgacgtagctggggctgtggtccgcttcatca

Exon 18 +      14117      14307   2   Internal    191   100   Excellent
ctcctgcccctggacagcagcaagagccgcctacttcgggagcgtgccgggctgggcgac
ctggagagcgccagcaacagcctggtcaccaacaggtgaggcagggactgggggttgggc
ccagtggaggcggggccgtggtgggcagggcccatgcccacagtttcttctctggcccag
CATGGCTGGCAGTGTGGCCGAGAGCTATGACACGGAGAGCGGCTTCGAGGATGCAGAGAC
CTGCGACGTAGCTGGGGCTGTGGTCCGCTTCATCAACCGCTTTGTGGACAAGGTCTGCAC
GGAGAGTGGGGTCACCAGCGACCACCTCAAGGGGCTGCATGTCATGGTGCCAGGTACGGG
GGTTTGGGCTG
gtgattcccccttggatgggtggggctgggcacaaagtgtgagaactgtcttcccccaga
cattgtccagatgcacatcgagaccctggaggccgtgcagcgggagagccggaggctgcc
gcccatccagaaggtttgcgggggccgttggggctgcgggggcccaaggcccgggctgca

Exon 19 +      14367      14440   1   Internal     74    77        Good
gctggggctgtggtccgcttcatcaaccgctttgtggacaaggtctgcacggagagtggg
gtcaccagcgaccacctcaaggggctgcatgtcatggtgccaggtacgggggtttgggct
ggtgattcccccttggatgggtggggctgggcacaaagtgtgagaactgtcttcccccag
ACATTGTCCAGATGCACATCGAGACCCTGGAGGCCGTGCAGCGGGAGAGCCGGAGGCTGC
CGCCCATCCAGAAG
gtttgcgggggccgttggggctgcgggggcccaaggcccgggctgcatcctgagctcctg
ctcttgttttcgagcagcccaagctgctgcggccgcgcctgctgccgggtgaggagtgtg
tgctggacggcctgcgcgtctacctgctgccggatgggcgtgaggagggcgcggggggca

Exon 20 +      14518      14757   0   Internal    240    89        Good
cacaaagtgtgagaactgtcttcccccagacattgtccagatgcacatcgagaccctgga
ggccgtgcagcgggagagccggaggctgccgcccatccagaaggtttgcgggggccgttg
gggctgcgggggcccaaggcccgggctgcatcctgagctcctgctcttgttttcgagcag
CCCAAGCTGCTGCGGCCGCGCCTGCTGCCGGGTGAGGAGTGTGTGCTGGACGGCCTGCGC
GTCTACCTGCTGCCGGATGGGCGTGAGGAGGGCGCGGGGGGCAGTGCTGGGGGACCAGCA
TTGCTCCCAGCTGAGGGCGCCGTCTTCCTCACCACGTACCGGGTCATCTTCACGGGGATG
CCCACGGACCCCCTGGGTGAGCCTGCAGACTCTCTGGCCCTGTCGCCCCCTCTCCCCCAG

gtctttgggatggatgggctttccctgcctccctctcccttttctcgggggttctgggtg
cccgtgggaaacgggcctttgtctgctccttccccacccacttgggattccccataactg
tggtaccctgagattctgggacccccccccccttaccttccttgcttctgactctgcctg

Exon 21 +      14961      15077   0   Internal    117   100   Excellent
cctgcctccctctcccttttctcgggggttctgggtgcccgtgggaaacgggcctttgtc
tgctccttccccacccacttgggattccccataactgtggtaccctgagattctgggacc
cccccccccttaccttccttgcttctgactctgcctggcctgtcctaagttggggagcag
GTGGTGGTCCGCTCCTTCCCGGTGGCTGCGCTGACCAAGGAGAAGCGCATCAGCGTCCAG
ACCCCTGTGGACCAGCTCCTGCAGGACGGGCTCCAGCTGCGCTCCTGCACATTCCAG
gtggggcgcggtgcgcgggtggggctctcatcccccgccctggtctttctcctgcaaacc
ggtctttcttgtatgaaccatttttaggccagtctccagcagtggccctgttgttacgct
tgcatgtctggggccctcactgtggctcttgagttgatgtccactgtttgatgtgcggtc

Exon 22 +      15524      15702   0   Internal    179    95   Excellent
cactgagatttcgagtttacacaagcgcttgccttcgtgtgacacagatacaggcctttg
cctggggcctgcttctctctctgtcatggctgcgaggggaaggggagcctggcagtgtca
gagttgggggaggggctggggggccacccacacccctaagggctgcttttactgacacag
CTGCTGAAAATGGCCTTTGACGAGGAGGTGGGGTCTGACAGCGCCGAGCTCTTCCGTAAG
CAGCTGCATAAGCTGCGGTACCCGCCGGACATCAGGGCCACCTTTGCGTTCACCTTGGGC
TCTGCCCACACACCTGGCCGGCCACCGCGAGTCACCAAGGACAAGGGTCCTTCCCTCAG
gtatggatctgggtcccaggcagggcagctgggcctcagccgtgttcccgctccaaccct
cctaggcccctgtgctcatctttgtccctcctcctctcacctttgctgactctcgtgggc
ctcagaaccctgtcccggaacctggtcaagaacgccaagaagaccatcgggcggcagcat

Exon 23 +      15828      15964   2   Internal    137   100   Excellent
cccacacacctggccggccaccgcgagtcaccaaggacaagggtccttccctcaggtatg
gatctgggtcccaggcagggcagctgggcctcagccgtgttcccgctccaaccctcctag
gcccctgtgctcatctttgtccctcctcctctcacctttgctgactctcgtgggcctcag
AACCCTGTCCCGGAACCTGGTCAAGAACGCCAAGAAGACCATCGGGCGGCAGCATGTCAC
TCGCAAGAAGTACAACCCCCCCAGCTGGGAGCACCGGGGCCAGCCGCCCCCTGAGGACCA
GGAGGACGAGATCTCAG
gtggaggggtgggggtggagtcctgggtggtctctggatgctgacattggccagggagga
tcagggcaggcggagtggccccgtgatgaccacgtgtgcccggcctgtgcagtgtcggag
gagctggagcccagcacgctgaccccgtcctcagccctgaagccctccgaccgcatgacc

Exon 24 +      16077      16284   1   Internal    208    71        Good
gtacaacccccccagctgggagcaccggggccagccgccccctgaggaccaggaggacga
gatctcaggtggaggggtgggggtggagtcctgggtggtctctggatgctgacattggcc
agggaggatcagggcaggcggagtggccccgtgatgaccacgtgtgcccggcctgtgcag
TGTCGGAGGAGCTGGAGCCCAGCACGCTGACCCCGTCCTCAGCCCTGAAGCCCTCCGACC
GCATGACCATGAGCAGCCTGGTGGAAAGGGCTTGCTGTCGCGACTACCAGCGCCTCGGTC
TGGGCACCCTGAGCAGCAGCCTGAGCCGGGCCAAGTCTGAGCCCTTCCGCATTTCTCCGG
TCAACCGCATGTATGCCATCTGCCGCAG
gtgagggccggccagggctggcccgggtggtggacacgtgactgggtgtcttccctgccc
gctgtgggcctgggccacggcttctggtcatgtaaggaatgtggagggggagactccggg
cagagggacgggccacagggctggggggtggctggggggccccgtggctgagctggaagc

Exon 25 +      16570      16766   2   Internal    197    95   Excellent
gggggagactccgggcagagggacgggccacagggctggggggtggctggggggccccgt
ggctgagctggaagcgcctcctgctgggagccatgggctggctcctcttgccctgcttgg
ggcgtgagcctggaggcgggtggggtcgccagccaccttcacgcctctgcctcctctcag
CTACCCAGGGCTGCTGATCGTGCCCCAGAGTGTCCAGGACAACGCCCTGCAGCGCGTGTC
CCGCTGCTACCGCCAGAACCGCTTCCCCGTGGTCTGCTGGCGCAGCGGGCGGTCCAAGGC
GGTGCTGCTGCGCTCTGGAGGCCTGCATGGCAAAGGTGTCGTCGGCCTCTTCAAGGCCCA
GAACGCACCTTCTCCAG
gtacctcctgcgtcctgccctgtgcctgccctgccctatctcaccctcccctccctcagc
tccgtgtcctcccccaggccagtcccaggcggactcgagtagcctggagcaggagaagta
cctgcaggctgtggtcagctccatgccccgctacgccgacgcgtcgggacgcaacacgct

Exon 26 +      16844      17004   1   Internal    161   100   Excellent
tgctggcgcagcgggcggtccaaggcggtgctgctgcgctctggaggcctgcatggcaaa
ggtgtcgtcggcctcttcaaggcccagaacgcaccttctccaggtacctcctgcgtcctg
ccctgtgcctgccctgccctatctcaccctcccctccctcagctccgtgtcctcccccag
GCCAGTCCCAGGCGGACTCGAGTAGCCTGGAGCAGGAGAAGTACCTGCAGGCTGTGGTCA
GCTCCATGCCCCGCTACGCCGACGCGTCGGGACGCAACACGCTTAGCGGCTTCTCCTCAG
CCCACATGGGCAGTCACGGTGAGGGTGCTTGTGGGCAGACG
gtggggcaggggcactttggggggccgtggtggcatttatggtttggcaggcaggccagg
gaggagcagaaacggcgctggtcatggatgtttgggtgtgggatgaggagcatgccctcc
gggtgccgtggggcaggggcgggaagcctgtccagaccaagtgtgtgcccagaccaggtg

Exon 27 +      19563      19753   1   Internal    191    62    Marginal
tgccaccccacgtctcagaatctgtgtgttccagccctcctctcgcacggccctgctggg
gtcctgccaaccacccctgccctgggagctcagccccctccctggaggccgggcccagcc
agccccaggtaagtggtgccctggccccctttgggtgcttacctggcatctccttcacag
GTAAGTGGGGCAGTGTCCGGACCAGTGGACGCAGCAGTGGCCTTGGCACCGATGTGGGCT
CCCGGCTAGCTGGCAGAGACGCGCTGGCCCCACCCCAGGCCAACGGGGGCCCTCCCGACC
CGGGCTTCCTGCGTCCGCAGCGAGCAGCCCTCTATATCCTTGGGGACAAAGCCCAGCTCA
AGGTGACTGGG
gtgcggggggtggggggtgagggtgggggctcggcagggggcttggggcctcatgtgtct
cacgggacttgtccggattcttttcagggtgtgcggtcagaccccctgcagcagtgggag
ctggtgcccattgaggtattcgaggcacggcaggtgaaggctagcttcaagaagctgctg

Exon 28 +      19841      20020   0   Internal    180    78        Good
gccaacgggggccctcccgacccgggcttcctgcgtccgcagcgagcagccctctatatc
cttggggacaaagcccagctcaaggtgactggggtgcggggggtggggggtgagggtggg
ggctcggcagggggcttggggcctcatgtgtctcacgggacttgtccggattcttttcag
GGTGTGCGGTCAGACCCCCTGCAGCAGTGGGAGCTGGTGCCCATTGAGGTATTCGAGGCA
CGGCAGGTGAAGGCTAGCTTCAAGAAGCTGCTGAAAGCATGTGTCCCAGGCTGCCCCGCT
GCTGAGCCCAGCCCAGCCTCCTTCCTGCGCTCACTGGAGGACTCAGAGTGGCTGATCCAG

gtctctgcactgccccgtccctctgcccgccttggtgctgggccctccccttgggtagag
ccaagtggacgggtctaggtttgcttgtctgacagtgtggagcgctggaaggaggaggtg
acagccacttcccacccaggctctggtgcctagaaggcagctgggaggctgggcctggct

Exon 29 +      20654      20755   0   Internal    102   100   Excellent
tggtcggcacacccagagcgagctgtgtttgtccagtgctctgcccgcatacagggcttg
gggggctgtggacagggcctgcctccccgctgcctgtggacatgcgggtctctggcctgg
tgagtggccaggcgggagggcggtgggtccccgaggtgctgaggccgcctgtccctgcag
ATCCACAAGCTGCTGCAGGTGTCTGTGCTGGTGGTGGAGCTCCTGGATTCAGGCTCCTCC
GTGCTGGTGGGCCTGGAGGATGGCTGGGACATCACCACCCAG
gtgtgtggcgcgtggggctggggtgggccaggctcccgggctcctcgctgacctcctggc
ggtgctggcaggtggtatccttggtgcagctgctctcagaccccttctaccgcacgctgg
agggctttcgcctgctggtggagaaggagtggctgtccttcggccatcgcttcagccacc

Exon 30 +      20827      21012   0   Internal    186    88        Good
cctgcagatccacaagctgctgcaggtgtctgtgctggtggtggagctcctggattcagg
ctcctccgtgctggtgggcctggaggatggctgggacatcaccacccaggtgtgtggcgc
gtggggctggggtgggccaggctcccgggctcctcgctgacctcctggcggtgctggcag
GTGGTATCCTTGGTGCAGCTGCTCTCAGACCCCTTCTACCGCACGCTGGAGGGCTTTCGC
CTGCTGGTGGAGAAGGAGTGGCTGTCCTTCGGCCATCGCTTCAGCCACCGTGGAGCTCAC
ACCCTGGCCGGGCAGAGCAGCGGCTTCACACCCGTCTTCCTGCAGTTCCTGGACTGCGTA
CACCAG
gtgggcaggccgctgtgtgggtgggccgggactgtgcaccctgaccgctgagccctggcc
cctgacccacatggcgtgcaggtccacctgcagttccccatggagtttgagttcagccag
ttctacctcaagttcctcggctaccaccatgtgtcccgccgtttccggaccttcctgctc

Exon 31 +      21094      21220   0   Internal    127   100   Excellent
ttcggccatcgcttcagccaccgtggagctcacaccctggccgggcagagcagcggcttc
acacccgtcttcctgcagttcctggactgcgtacaccaggtgggcaggccgctgtgtggg
tgggccgggactgtgcaccctgaccgctgagccctggcccctgacccacatggcgtgcag
GTCCACCTGCAGTTCCCCATGGAGTTTGAGTTCAGCCAGTTCTACCTCAAGTTCCTCGGC
TACCACCATGTGTCCCGCCGTTTCCGGACCTTCCTGCTCGACTCTGACTATGAGCGCATT
GAGCTGG
gtatgtggggagtcggggctggggcagccacgggtcaggaggggcccaggctcagtgctg
cttctgtgcagggctgctgtatgaggagaagggggaacgcaggggccaggtgccgtgcag
gtctgtgtgggagtatgtggaccggctgagcaagaggacgcctgtgttccacaattacat

Exon 32 +      21292      21422   1   Internal    131   100   Excellent
atggagtttgagttcagccagttctacctcaagttcctcggctaccaccatgtgtcccgc
cgtttccggaccttcctgctcgactctgactatgagcgcattgagctgggtatgtgggga
gtcggggctggggcagccacgggtcaggaggggcccaggctcagtgctgcttctgtgcag
GGCTGCTGTATGAGGAGAAGGGGGAACGCAGGGGCCAGGTGCCGTGCAGGTCTGTGTGGG
AGTATGTGGACCGGCTGAGCAAGAGGACGCCTGTGTTCCACAATTACATGTATGCGCCCG
AGGACGCAGAG
gtaagctggggcctgggtcgggtaggcggctcctgcccgacccaggtcctcaaccacagg
cccaccctcaggtcctgcggccctacagcaacgtgtccaacctgaaggtgtgggacttct
acactgaggagacgctggccgagggccctccctatgactgggaactggcccaggggcccc

Exon 33 +      21494      21724   0   Internal    231    85        Good
ggaacgcaggggccaggtgccgtgcaggtctgtgtgggagtatgtggaccggctgagcaa
gaggacgcctgtgttccacaattacatgtatgcgcccgaggacgcagaggtaagctgggg
cctgggtcgggtaggcggctcctgcccgacccaggtcctcaaccacaggcccaccctcag
GTCCTGCGGCCCTACAGCAACGTGTCCAACCTGAAGGTGTGGGACTTCTACACTGAGGAG
ACGCTGGCCGAGGGCCCTCCCTATGACTGGGAACTGGCCCAGGGGCCCCCTGAACCCCCA
GAGGAAGAACGGTCTGATGGAGGCGCTCCCCAGAGCAGGCGCCGCGTGGTGTGGCCCTGT
TACGACAGCTGCCCGCGGGCCCAGCCTGACGCCATCTCACGCCTGCTGGAG
gtgcgtgtgatcccagagcagggtctggcctggcacccccctcctctcgctcagacacca
gggtcgtgcgtgtgtgtgtacactcgtacatgcacgtaagtccggttacccctgggggtt
ggtgtggccctgccgtctccccaccatgtgaactgcctactggcctggggtggctgtggc

Exon 34 +      27586      27693   0   Internal    108   100   Excellent
ttgtctccgaatattcattttgcatattccttccctccctcttgccacctccccctgtgg
ccagtcacacacgcgttaggcctttccgttgtgtctctttcctgtgttttccttttgtct
tttcgtgctctagtctggatatttccttttgaataaacttgccattaattcttcccccag
GAGCTGCAGAGGCTGGAGACAGAGTTGGGCCAACCCGCTGAGCGCTGGAAGGACACCTGG
GACCGGGTGAAGGCTGCACAGCGCCTCGAGGGCCGGCCAGACGGCCGT
gtgagtgagggccagtgtgagcgtccacggtgggcgtgttgctgggagaaagtggagtct
gtccagccctgacccaagtcccaacctcctgttcccagggcacccctagctccctccttg
tgtccaccgcaccccaccaccgtcgctcgctgggtgtgtacctgcaggaggggcccgtgg

Exon 35 +      27792      28048   0   Internal    257    87        Good
gggccaacccgctgagcgctggaaggacacctgggaccgggtgaaggctgcacagcgcct
cgagggccggccagacggccgtgtgagtgagggccagtgtgagcgtccacggtgggcgtg
ttgctgggagaaagtggagtctgtccagccctgacccaagtcccaacctcctgttcccag
GGCACCCCTAGCTCCCTCCTTGTGTCCACCGCACCCCACCACCGTCGCTCGCTGGGTGTG
TACCTGCAGGAGGGGCCCGTGGGCTCCACCCTGAGCCTCAGCCTGGACAGCGACCAGAGT
AGTGGCTCAACCACATCCGGCTCCCGTCAGGCTGCCCGCCGCAGCACCAGCACCCTGTAC
AGCCAGTTCCAGACAGCAGAGAGTGAGAACAGGTATGAGGGCACCTCCCACTGCCACATG
GACACCTCTGAGCTGGT
gttctggggtcccaggcagtcctctggtgggagattgcgggtgcttttgaggagcttgct
taagtatacaccaccactgggaggggtttggggtgtcgaactggtgaccacagctgacca
cagcctgcagtggctgagggaggagtagagagagggcagtggtggggcccccgtgagtct

Exon 36 +      28627      28714   2   Internal     88    98   Excellent
ccccccatcaaaggcttctttgtggccccctggccagtgctctgggcttaggtcagttct
ggggacagggtgcctggtcttacctcctgggctgggacagcaagggggggacgactgctg
gggcctgggcttggctgggccatgacggtcagcctggccctggttctgctggaaatgcag
GTCCTACGAGGGCACTCTGTACAAGAAGGGGGCCTTCATGAAGCCTTGGAAGGCCCGCTG
GTTCGTGCTGGACAAGACCAAGCACCAG
gtgagtgatcaggtggtgggggggactcacgggggagggggctccgctgactctgtggcc
tcctccagctgcgctactacgaccaccgtgtggacacagagtgcaagggtgtcatcgact
tggcggaggtggaggctgtggcacctggcacgcccactatgggtgcccctaagactgtgg

Exon 37 +      28783      28914   0   Internal    132   100   Excellent
gccctggttctgctggaaatgcaggtcctacgagggcactctgtacaagaagggggcctt
catgaagccttggaaggcccgctggttcgtgctggacaagaccaagcaccaggtgagtga
tcaggtggtgggggggactcacgggggagggggctccgctgactctgtggcctcctccag
CTGCGCTACTACGACCACCGTGTGGACACAGAGTGCAAGGGTGTCATCGACTTGGCGGAG
GTGGAGGCTGTGGCACCTGGCACGCCCACTATGGGTGCCCCTAAGACTGTGGACGAGAAG
GCCTTCTTTGAC
gtgagccttggccggggcttgggagaggggaggggctctgcggtgtgggggctgcggagt
cagtaacccgcccttccccaggtgaagacaacgcgtcgcgtttacaacttctgtgcccag
gacgtgccctcggcccagcagtgggtggaccggatccagagctgcctgtcggacgcctga

Exon 38 +      28996      29094   0   Terminal     99    63    Marginal
tgcaagggtgtcatcgacttggcggaggtggaggctgtggcacctggcacgcccactatg
ggtgcccctaagactgtggacgagaaggccttctttgacgtgagccttggccggggcttg
ggagaggggaggggctctgcggtgtgggggctgcggagtcagtaacccgcccttccccag
GTGAAGACAACGCGTCGCGTTTACAACTTCTGTGCCCAGGACGTGCCCTCGGCCCAGCAG
TGGGTGGACCGGATCCAGAGCTGCCTGTCGGACGCCTGA
gcctcccagccctgcccggctgctctgcttccggtcgttaccgaccactaggggtgggca
gggccgccccggccatgtttacagccccggccctcgacagtattgaggccccgagccccc
agcacttgtgtgtacagcccccgtccccgccccgccccgcccggccggccctaacttatt

Exon 39 +      30492      30517   0   Internal     26    51    Marginal
tcaggtgggaggcgagcagcaggtgtgggtgaggggaaggttctgatgacagctgcagag
gcagggcccagtgctggcaggtggggggccaagaccctcccctggtgggacgttgaagcc
aaggatggccttggaccctgtcaggcccagcatggtcccgccacctcccccaccccacag
GTGGTGTTGGGACACCTGGGCGAGAT
gtgagggtgggctcacttgagccactgaaaccagccaggtcttccctcaggccggacaga
tggcgcctgaccgaagttcctggcacctggaaaacccacaggtcagagtaag
Exon 40 +      30568      30628   2   Terminal     61    52    Marginal
gcaggtggggggccaagaccctcccctggtgggacgttgaagccaaggatggccttggac
cctgtcaggcccagcatggtcccgccacctcccccaccccacaggtggtgttgggacacc
tgggcgagatgtgagggtgggctcacttgagccactgaaaccagccaggtcttccctcag
GCCGGACAGATGGCGCCTGACCGAAGTTCCTGGCACCTGGAAAACCCACAGGTCAGAGTA
A
g
--------------------------------------------------------------------------------