--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (21024 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3675       3719   0    Initial     45    81        Good
ggcgcggctggactgagccgctcccgctgcgctcagagtccgggcccctggcgccatgcc
aggcccggcgggcgtgcgcccggcgcgcagcactgcagcgctggtcatatgagcagaaat
gatgagaaaagcactttttaatcttttcgcacttgctctgcccgctcaaacagttgcagg
ATGTCGATGACAGACTTGCTGAACGCTGAGGACATCAAGAAGGCG
gtgggagcctttagcggtgagcaagcgcgctcccctccccatccctctcccctcgtccac
cgcccgcgcccctgcactccgccggccccgcagccggcggatcctccccagcgcgcttct
gcccacacttcccgctgggcgccggcgaggtcggggcgggggcgtccttggcagttccca

Exon  2 +       5405       5577   0   Internal    173   100   Excellent
ctgggtttgagcacacctcttccactcccagccttgtgaccttggacaggttatcctccc
ttgcccgggctccctcagccctccaatggaggtgggtacctctcattccccatgactggc
atgtgggaatccatcaacaaatgccttgatgccccccattctcccaggcttccctaccag
CCTTTCTGGTCCTTGTTTGACCCTGCTCTTCCCCCCACAGCTACCGACTCCTTCGACCAC
AAAAAGTTCTTCCAAATGGTCGGCCTGAAGAAAAAGAGTGCGGATGATGTGAAGAAGGTG
TTTCACATGCTGGACAAGGACAAAAGTGGCTTCATCGAGGAGGATGAGCTGGG
gtaagcggaggcctgcaggggctgcccagcccacggctgcacgagagggagtgggggctg
ggactctagcttccaagtgtccatcagacctgcctttcactctgcctgcttcacagaaag
taaccgtgcgtgaaggcagggctccgacccagggcaccaggggagaaggcttcctggtgc

Exon  3 +       6925       7034   2   Internal    110   100   Excellent
acgaaagcacagccaccgagcaggctacctggcccagagcatccgtgtgcgtgactgctg
ctcgctgcctgtcccagccatccctttccccatacagaaaccagaccaccctccatccag
cgtcctgcaaggcgacctcggcctgactccctcaccggctttctcccttttctcctccag
ATTCATCCTAAAAGGCTTCTCCCCAGATGCCAGAGACCTGTCTGCTAAAGAAACCAAGAT
GCTGATGGCTGCTGGAGACAAAGATGGGGACGGCAAAATTGGGGTTGACG
gtgggtagccgtgacctggggtctgggcatattgtggatcttggggtgttggatgcgaaa
agtttgaagctatgtctgtcacaaggaagggatgatatgggggtccctcactcccccaga
ttagaagacaaaaagcagtccattaggtctgagagctctgccacatactccagacaaagg

Exon  4 +       7598       7693   1   Internal     96    79        Good
tctaatccaacgaaatgaggccgactaatccccaaggatcctctgcctctcacatcctca
gattccagggatggaaattcctatctcctgtcctcctcagcatcttgtcctggtgtcctg
taaccccaagtctcaaaacctgtttgggttttactcaaatatactattctagccttgcag
CAGAGCCAGGAAAAACAGTAAACCAGAAATCAGTGGGGAATTCAGACAGGGAATACCTGG
CCCTGCCTTGCTTTGCAGGCTTCAATGTCAGCACAG
gtgagagaccagtggcccaccgtccactcctttctccatttggctctgtgtggcattcat
ggagcacacccacattgctatctctcttagcttatgattttctccggaattatctccatt
ttgcaggtgggcaaatggactttgaaggtgcttagcctagttgaaagagctaggacatag

Exon  5 +      12567      12673   1   Internal    107    73        Good
tgtgtgccaagtacagcacacaggccttacatcttttaactcattcaaacctcccaacag
ctctacaagatatttttgttactgatacatacaaggaatctgaggccccgggaagcagag
cgacttgctgtgaagcctcagggccctcttcaaaccttgactcctaatatcttgctgcag
AGAAGATCCGCATGCCCCGTGTGCACACGTGCCTGCACGCAGTCCTAGTTACATTCTTCC
TGAAACCCATTCCCGGCGATGGATCCACTGCCCTCTGCTTTAAGTGT
gtctcaactcaagagtttggggtttgcattttgcttctgttgctgaaacatgtagtcatc
attattgcctaaccttgcaacccccccaccccttgccactcactcgcatgcctgaaggaa
tttgccttttctgcttccctctggcaaaatctgttcccttttatccttaagtagcctatt

Exon  6 +      17937      17992   0   Internal     56    55    Marginal
ccctatgggagggattctgtacgagtatttgttgttttggtatttatttgagactccatc
cttggcactgctgttaccactcagccagagagcctggagatttcaaaaccagctggtgga
ccctcactctctcccaccctgcatcccccatatccaggtcacccacttttcctatcctag
GACAGCCTGGGGACAGGAAAGGATGATGTCTATTTCCTAAGTCAAACCTCAGGAAG
gtgaggcacccaggtacgtgtcccttcatctagccagggccagtgccaggttgtttcttt
ctttttttttttttttttttttttgtgtgagatggagtctcactctgttaccaggctgga
gtgcagtggcacgatctcggctcactgcaacctctgcctcctgtgttcaagcaatcctcc

--------------------------------------------------------------------------------