--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (26171 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1467       1748   0    Initial    282    76        Good
gggtccccaccatgcagctgaagtgccagggtgcttgtgaagtctaagcccttgtctggc
atttgtcaggaatatagggtgaggcctctgggaccgagcggggcggggcggggcggggcg
gggcggggcgggaccaacagcgcacacttaagcggcccgggcgggtaccgccgtcccgcc
ATGGCTCTGAGGCGCGCCCTGCCCGCGCTGCGCCCCTGCATTCCCCGCTTCGTCCCGCTG
TCCACGGCGCCGGCCTCCCGCGAGCAGCCCGCAGCGGGCCCAGCGGCCGTGCCAGGAGGT
GGGTCGGCCACGGCAGTGCGGCCGCCGGTGCCCGCCGTGGACTTCGGCAACGCGCAGGAG
GCGTACCGCAGCCGGCGAACCTGGGAGCTGGCGCGGAGCCTGCTGGTGCTGCGCTTGTGC
GCCTGGCCCGCGCTGCTGGCGCGCCACGAGCAGGTGCGCGGG
gtgcaggcgggggcgcgggggcttctgccggtcccgggagcctttacggagcttcctggc
ctgaaacgggtgcctcccaagcatctcctggagcaagggaagccaggaagggaggcgttt
cctgcagtccctctcggacctcgcaaattttcctatttgtcgatgtctaccaactaaaaa

Exon  2 +       6556       6764   0   Internal    209    91   Excellent
ggagaagcaagcggctttagctggtcttcaccatgaaactgaccctgaaagcccagtcgc
caagagaccatatcgaggccccatggctggggtgaagtgtggtcggggatgagcagcggt
gccttgctgggaaaggagagttcaggcagcccaggacagcggcttccctttgcctttcag
CTGCTGTATGTTTCCAGGAAACTTCTAGGACAGAGGCTATTCAACAAGCTCATGAAGATG
ACCTTCTATGGGCATTTTGTAGCCGGGGAGGACCAGGAGTCCATCCAGCCCCTGCTTCGG
CACTACAGGGCCTTCGGTGTCAGCGCCATCCTGGACTATGGAGTGGAGGAGGACCTGAGC
CCCGAGGAGGCAGAGCACAAGGAGATGGA
gtaaggcctgcccggtgtctgcgggctttctgatcatgaccctggagcacccagtgggag
caggtgggatgtatccagctgctgggcttcagcctcagctgggcagaggccaaggctagg
agagcttggtcagcccaactaccgatgaccctcctgggctctgcctggagttcttgcatt

Exon  3 +      10078      10172   2   Internal     95    82        Good
gctgcccctctggccactgcacgtgctgtgtggtcatcttggccactgcttggctgtgtc
agcctggtctgtgctctggaagttcacggagaggagcagcggtagcctatggtgttctgc
ctctgagtgtgtcagagcaggagagggagcagccctggcttccccagcctctcctgccag
GCCCACCTCAGAGGATGAACACAGCAGCTGTGGGAATGCTGAGCGGGAACTCATCTGCCT
GGGGACCTGTCAGATAATGATCCTGTTTCATGAAG
gtgagctgcctcacaggcagacacctgtgtggttaagtcccgtgttatccaaactgtggg
ctgtgtggtttcaggatgggaccttctcttcagggtcatggaggcccctgaggccctgtc
cccactgtctgctgttacttgccatgagggtttctgccctgggcagggccctggctgcca

Exon  4 +      12032      12066   2   Internal     35    73        Good
gcccctcccaggcccaagtgttccaccccaggctaggggtggggctggggctgcaccttg
gaatctaccctccaccggggttgtggtggggccctccgtgcagcctcagtgggaacgtgc
ctgtcacctgaggctcaggtggcgtgaccctgacctttgctctccccctccttcccacag
GTCCTGCACCTCAGCTGCGGAGAGGGATGGCAGTG
gtgagtgagaggctgccgcgcaggaacagactccctcccgactccgcacaccccttggtg
gctcaggagagtctaggctggggcacaagtgggccttggggtgacgtcggagcccgggct
cctccctatgtccagggcacctgccctgtcgctctgggctctgacatactcgcaagtgtc

Exon  5 +      12554      12779   1   Internal    226   100   Excellent
ggtgtagacaggagggtgggcttggggatgggaaccatggggcagtgcagtgccagggcc
aggctggcaaggccactatgcttggagccctcctgagggcaggggccctgggctattggt
gtgtgggtgctgggggtgggtgtttggagctgtgctcaggccgtgcattcgctattccag
GCACGAATAAGCGGGACAAGCAATACCAGGCCCACTGGGCCTTCGGGGACCGCAGGAATG
GTGTCATCAGTGCCCGCACCTACTTCTACGCCAATGAGGCCAAGTGCGACAGCCACATGG
AGACATTCTTGCGCTGCATCGAAGCCTCAGGTGGGGCCCCCTCTTTGCTGGCTATACCCC
TGCCATGTCCCAGCCTGAGCGGACCCCTGGGCTCATGGAGGTGCCG
gtgggtgaacactaagctggggcaggagccagagggctgggttctgaccacacttgggtc
cctcactgttcagccccttcctgaggggccccactgcctcccagaaggcatctcctctcc
tgccccagctccctgttccctgatcccgcctcatgccccccacccttctccctggctcag

Exon  6 +      14784      14937   2   Internal    154    84        Good
attaagctcacagcactggggagaccccagtttctggtaagtgctagaaccttccacctg
cagagtctggtgctgtgcgagatctcagggcagctgtgggcatccaccaaaaacacaggt
gcccatgccttagaggcctgagctggccacaggggctgtgtgggggactggggtgggcag
GGGCGTGTGCAGATGGCATTCAGGCCTGCGTTTGCAGCTGCAGTTCTCAGAGGTGCTGGC
CAAGTGGAGGTGCTTCTTTCACCAAATGGCTGTGGAGCAAGGGCAGGCGGGCCTGGCTGC
CATGGACACCAAGCTGGAGGTGGCGGTGCTGCAG
gtggggcagccttccccttccccactcctgtggcttgtgagggggtgggcaccgtggggt
cacacggggcatggtgggcagtggtcggaggtggttttgggaactcacccagggcatgtg
gctcactctgcagctgctggggttggcctggtggggaggaggaggtcagagggactctga

Exon  7 +      16331      16412   2   Internal     82    95   Excellent
cactggttttaaatttttaaacagaaaacaatatttatatttcctctgtcttttaaaact
gaacaccgaggtgggttttgtggtgggtggtgaacggacaggtttgggcctcgatccccc
acccgaccctagcacccacaggtgggggtgccccctctgctgatgcgcctcctccctcag
CACCATGGACCTGCTGGACTGGAGCAGCCTCATCGACAGCAGGACCAAGCTGTCCAAGCA
CTTGGTAGTCCCCAACGCACAG
gtaacacctccgctcctcagtgaggcccagctcagcagggcgctgcgctaagaagggaat
tcagcctgccacgtgtgtctcttgttgcctaccctgggaacttaacatgaccaaaatcac
tgcacactatggccccacagaccccctgtggtccagggggaagaagacaagcccactagt

Exon  8 +      17956      18048   0   Internal     93    88        Good
ctggctgcgttggaggttcaggggcactgtgctgcttgtccaggtggccctccctcccag
ccctgcacagacgggtgagagggttcctgtgggctgggaatactgagagaggtttagcct
gggcctcagggtggcactttcccgcccttgctgtggcctgaccgcgtgttgcacccccag
ACAGGACAGCTGGAGCCCCTGCTGTCCCGGTTCACTGAGGAGGAGGAGCTACAGATGACC
AGGATGCTACAGCGGATGGATGTCCTGGCCAAG
gtgagctgtcccgctcgggcagagggtacctgggactcgtggagaagagggcacctgcct
cacttgagcaacagttgctcccactctcccaccccctgcgcctctcagaaagccacagag
atgggcgtgcggctgatggtggatgccgagcagacctacttccagccggccatcagccgc

Exon  9 +      18157      18396   0   Internal    240    94   Excellent
ctgtcccggttcactgaggaggaggagctacagatgaccaggatgctacagcggatggat
gtcctggccaaggtgagctgtcccgctcgggcagagggtacctgggactcgtggagaaga
gggcacctgcctcacttgagcaacagttgctcccactctcccaccccctgcgcctctcag
AAAGCCACAGAGATGGGCGTGCGGCTGATGGTGGATGCCGAGCAGACCTACTTCCAGCCG
GCCATCAGCCGCCTGACGCTGGAGATGCAGCGGAAGTTCAATGTGGAGAAGCCGCTCATC
TTCAACACATACCAGTGCTACCTCAAGGCAAGCCCCCGCTCAGCCCCTCCCTGCCTGCCC
TGGGGCTTGGAGACCCCACAGGAGGGGCTCCTCTCATCTGAGCTCCCTGGCATTTGGCTG

gttttacactcagcacccaccagggagctcatgggatggaggagggagtgggccgtgccc
ccaaggggttgttggggtcttctgcagcacagctcacccagcgggccccagggtccagga
aagagccccttaggtggtggccacagccaggcctgcagaggaggctgaggccagggtgac

Exon 10 +      19263      19438   0   Internal    176   100   Excellent
ccttggggacagaggttggaggcccatcctcacccacacctgctccaggtgccctgagct
gcacctccccaggcagctgctgcccagccctggtgactgcacctgggcccaggaaggccc
catcctgctgtcacttgggcttgcccaggctccctgtgacttttggccctggccccacag
GATGCCTATGACAATGTGACCCTGGACGTGGAGCTGGCTCGCCGTGAGGGCTGGTGTTTT
GGGGCCAAGCTGGTGCGGGGCGCATACCTGGCCCAGGAGCGAGCCCGTGCGGCAGAGATC
GGCTATGAGGACCCCATCAACCCCACGTACGAGGCCACCAACGCCATGTACCACAG
gtgcgcagctctcccacccctctgtcttctcagggcagggcgccaagaaaccaggcctga
gggagaggcttggagactgaacttgtcagccacatgtgtccccaggtcagaactggtatt
tcctcagcttttatgtcatgtgttactttttcaaaagcattaaggttattcttttataaa

Exon 11 +      20766      20864   2   Internal     99   100   Excellent
atgaggtgctgggaggggcagatgctgctcctgttcctcctgatcctgtggatacccttg
gaaagagccagctcaatggatggatctgggtctgccctcggcctcctctctgtgcagctg
gtaatgagaggtgcaggcagccacaggcctggaactgggctcacatggcactctccacag
GTGCCTGGACTACGTGTTGGAGGAGCTGAAGCACAACGCCAAGGCCAAGGTGATGGTGGC
CTCCCACAATGAGGACACAGTGCGCTTTGCACTGCGCAG
gtaggtgtgccccaccctgcaccgaaaccccaacctgagccgttgtctcctccggctggg
gagaggtggcagcagcgcagagctcagggtgggcagagcgacctgctgggtggtcgggca
tttgtggggaaaggctggtgaaatgagctggagggtggcttcagtgggcaggcccaggcc

Exon 12 +      24228      24316   2   Internal     89   100   Excellent
ggggcagggccaggcagagcccataccccagccccaccttgcaggggatgaagtctggag
agtgcagatggggcacctgggatggcaggacaggctcagagctgggacaggagccctgta
tccctgcactggggacagtgtcctggaactggccctcagttcctggcttcacctgcacag
GATGGAGGAGCTGGGCCTGCATCCTGCTGACCACCGGGTGTACTTTGGACAGCTGCTAGG
CATGTGTGACCAGATCAGCTTCCCGCTGG
gtgagtggggccctccctggtgcgatggggtacggtgctgggcctgggcctcatggtgta
tctgcccccatgcaggccaggccggctaccccgtgtacaagtacgtgccctatggccccg
tgatggaggtgctgccctacttgtcccgccgtgccctggagaacagcagcctcatgaagg

Exon 13 +      24228      24579   2   Terminal    352    89        Good
ggggcagggccaggcagagcccataccccagccccaccttgcaggggatgaagtctggag
agtgcagatggggcacctgggatggcaggacaggctcagagctgggacaggagccctgta
tccctgcactggggacagtgtcctggaactggccctcagttcctggcttcacctgcacag
GATGGAGGAGCTGGGCCTGCATCCTGCTGACCACCGGGTGTACTTTGGACAGCTGCTAGG
CATGTGTGACCAGATCAGCTTCCCGCTGGGTGAGTGGGGCCCTCCCTGGTGCGATGGGGT
ACGGTGCTGGGCCTGGGCCTCATGGTGTATCTGCCCCCATGCAGGCCAGGCCGGCTACCC
CGTGTACAAGTACGTGCCCTATGGCCCCGTGATGGAGGTGCTGCCCTACTTGTCCCGCCG
TGCCCTGGAGAACAGCAGCCTCATGAAGGGCACCCATCGGGAGCGGCAGCTGCTGTGGCT
GGAGCTCTTGAGGCGGCTCCGAACTGGCAACCTCTTCCATCGCCCTGCCTAG
cacccgccagcacacccttagcctccagcaccccccgcccccgcccaggccatcaccaca
gctgcagccaaccccatcctcacacagattcaccttttttcaccccacacttgcagagct
gctggaggtgaggtcaggtgcctcccagccctgcccagagtatgggcactcaggtgtggg

Exon 14 +      24628      24706   0   Internal     79    91   Excellent
ctgccctacttgtcccgccgtgccctggagaacagcagcctcatgaagggcacccatcgg
gagcggcagctgctgtggctggagctcttgaggcggctccgaactggcaacctcttccat
cgccctgcctagcacccgccagcacacccttagcctccagcaccccccgcccccgcccag
GCCATCACCACAGCTGCAGCCAACCCCATCCTCACACAGATTCACCTTTTTTCACCCCAC
ACTTGCAGAGCTGCTGGAG
gtgaggtcaggtgcctcccagccctgcccagagtatgggcactcaggtgtgggccgaacc
tgatacctgcctgggacagccactggaaacttttgggaactctcctcgaatgtgtgggcc
caaggcccccacctctgtgacccccatgtccttggacctagaggattgtccaccttctgc

--------------------------------------------------------------------------------