--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (16488 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4263       4391   2   Internal    129   100   Excellent
ttttagtagagatggggttttgccttgttggccaggctggtcttgaattcctggcctcaa
gtgatccgcccacttcaatctccgaaagtaccaggattacaagtgtgatccaccgtgcct
ggcccctctttgattcttttaagtgatgctctaagtaactgatctcttcttcctgtacag
TTTTGATGGCGACGACTTTGATGATGTGGAGGAGGATGAAGGGCTAGATGACTTGGAGAA
TGCCGAAGAGGTCAGTATTCAGCCTCAGGCTCCCACCTCTGCAGCCCAAGCTGCCAAATC
GTCTGACAG
gtgatgattagctgaatgtgtctgccttctatttgtggtcaaggcccctgccataagcat
tcccagttagagtgagctgtgttccagtcttgcatagcagaacagccctgcagggtgggc
ctgaaagcttttgtccatgtggtccacagcctgtggcttctggggcagttagttcactga

Exon  2 +       6836       6966   0   Internal    131   100   Excellent
tgcctcataaggttattgtaaggattacatgagttgttaggaagcagttatgtggtcccc
tggcatgcagtaagcattaacggtggctgtagcgagaattgtgattgttgtcattatcac
tctccctgtaacccaaaagtgccacctgagtctttccctcttttttgtcttggtgtccag
GAAGGCCAGGAGAATGTCGAGATCCTCCCCTCTGGGGAGCGACCGCAGGCCAACCAGAAG
CGAATCACCACACCATACATGACCAAGTACGAGCGAGCCCGCGTGCTGGGCACCCGAGCG
CTCCAGATTGC
gtgagtgattgccccttcactgtcttctccatctgtcaggccacagtaagctcttgtacc
gctgatctttcccagcctggcacctgaaaacagactctctgctctcacattccaaaagtg
gtgccgtccctgcgtaccaggcattgagctagtcccctgccctcagggagcttgtgatct

Exon  3 +      14589      14660   2   Internal     72   100   Excellent
gataggcctctgccagggaagatctctggcagtgcccctacacaccactccctactgtgc
ctgcctacctagaagatgacgtttctaggtggggaccaggatgccgttccaccctcactg
cctgttgggcccttctccctgggtttgtagtctccctaacacctgtccctatccctacag
GATGTGTGCCCCTGTGATGGTGGAGCTGGAGGGGGAGACAGATCCTCTGCTCATTGCCAT
GAAGGAACTCAA
gtaagtcactcaaatcatggttcacttctccaaatctctgggaggcatctgttgggctct
ctgttgcaccctttgctcccacttgcctggctggagaagttgatgcttattcctacagat
ccttaggaacagctcaccaggaagtaggaggaagagagaagaggaggcagggaaagtggg

Exon  4 +      15115      15205   2   Terminal     91    95   Excellent
cttgtctgatataaaaactttctttttcttgtaattgctttcttacaaagtacactcatc
agccccaagaggctgctcctaagacttctctttgcttgtgttttgcacacaatctgttcc
ttctgcggcagagctggggtcaccagccctcatgtacttgtgacttctcccctgccacag
GGCCCGAAAGATCCCCATCATCATTCGCCGTTACCTGCCAGATGGGAGCTATGAAGACTG
GGGGGTGGACGAGCTCATCATCACCGACTGA
gctggagtcatcttcctgcccttgccccatgcccaattttcattctcactttatatgtgt
aaataataaaatattcaactttccaacccccttcccctctgcttatctgcaatgtcacca
cctgttgcttccccgttaccgccatgctgcgtggagcatgcacctattccagtggccctg

--------------------------------------------------------------------------------