--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (97615 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      14332      14366   1   Terminal     35    53    Marginal
aaacgtagaattagagaattttaagcctggaagagatttttagccatgagtactttccag
tcatatcaccccagacttttggacctgattttcatttatttagatcttgaacttgaaatt
gcagacatttacagtgaagggacgttgagataatctggctcgactctcctaatttcacag
ATGAGGAAACCAAGGAAGAAACTGAGGCCCAATGA
tgtctgagtggtttgttcaaaccacagtgttagctgcttctctgatatcatttccccttt
attgcactgattctccatatgtactatgtgtgtacagggttgttgttttttccctaaact
gtcctctctctattctagatctgatgacattcctctatgtaattgtagaaatcactgctc

Exon  2 +      22341      22503   1   Internal    163   100   Excellent
tgagggtaccttgtttcagatttattcagccccagaagtgttaactgcactgtgtccagg
atctagcaagacactatccatttccagcttggtccaaacaaaacaaaacatcaaccaaag
agggaggaaaccatgaatgttgccagaaaattagtttgctctgtcttttttttcttctag
AGTGTTTCACAGCCAATGGTGCGGATTATAGGGGAACACAGAACTGGACAGCACTACAAG
GCGGGAAGCCATGTCTGTTTTGGAACGAGACTTTCCAGCATCCATACAACACTCTGAAAT
ACCCCAACGGGGAGGGGGGCCTGGGTGAGCACAACTATTGCAG
gtaagatggggccactcagtactttaaaaagatagatatatatctagtctcttcttccaa
cccctttcatcccagctcacaactaggggaagtcttttgaccaactcaagagacttatct
tgtcagttttaaaaatatttctttcacaccttacacacacacacacacacacacacacac

Exon  3 +      26945      27087   2   Internal    143   100   Excellent
atgtttgttcttgtaatattaccattttttcccttttgatgagagatggcactgagatac
agaccaactattagaaataatacagaagctaaagcatttccttttctgtaaaactgaaaa
gcaatgaaccagttgaattaaaacatcagaagtcatcaattgtgtccttttccccaacag
AAATCCAGATGGAGACGTGAGCCCCTGGTGCTATGTGGCAGAGCACGAGGATGGTGTCTA
CTGGAAGTACTGTGAGATACCTGCTTGCCAGAGTAAGACTGTAATACCCAATGTGATGGT
TTACAGGACTGTGAACACTAAGA
gtgcgtagagggaggcccctgccagaggtcaggtagttaggctggtggatttcatggagc
atgtgaaaggagaagccatcctgggcgaggattttcacttctcttgttgaggcttttcag
gaataggaatgctgatttccttagcacctcattctaaaggtattcccttgatgggtaagc

Exon  4 +      40179      40315   1   Terminal    137    54    Marginal
gatttggttaccaggactagaactcattcaagctaacttgagcaaaagaaatcaatttga
agaccattgggatgtatcacagaacccaaaccctgtatcccaagaaactagaaagaaagc
agggactttcactatctgtctctgtggccacttcatctcccttctctgcctctctctcag
CTTGTTATCCATCCTTCTTCCTCTTCGTGGACCAGCAGAATTGGCTCATTCATCCACTCA
CGTGGCTCAAACTTGAGTTTGGTTGCCTCAACTCCTACTTGACAAATCCCTACAATTTCA
GTGCTTGCATTCACTGA
gcggatcccaattccagcttcctaagaaagagaatctggtggccccagtgtgaggcagct
gtggccagaggatggagccctttgtcttgtccccagccagcagtagttatgggagcagat
gctctgagaaggtgctgtgggtaataggtggttctcaaagaacagctgtcagccatggag

Exon  5 +      40387      40507   0    Initial    121    50    Marginal
ggaccagcagaattggctcattcatccactcacgtggctcaaacttgagtttggttgcct
caactcctacttgacaaatccctacaatttcagtgcttgcattcactgagcggatcccaa
ttccagcttcctaagaaagagaatctggtggccccagtgtgaggcagctgtggccagagg
ATGGAGCCCTTTGTCTTGTCCCCAGCCAGCAGTAGTTATGGGAGCAGATGCTCTGAGAAG
GTGCTGTGGGTAATAGGTGGTTCTCAAAGAACAGCTGTCAGCCATGGAGGCCCCCATGGA
G
gtgtgtgcagtaccttcacaatgaagccacagttatattcaaatgtaacaatgtttagtg
ggcctgcctgattgcttcccagttgtttcttatgatagtaaaagaacaatagttcctggg
ttaatgtgaatggaggaccttctctctttaactcctccaaaatttttatcttcaacatct

Exon  6 +      43315      43372   0    Initial     58    48    Marginal
agtctgctttccactttcactctaccttattcattcactctgcccaagaagtacctttat
ccactctaatggcattcgcagcaacctggatgggattggagattatattccaagtgtgaa
ggaactcaggaatggaaaaccaaacattgtatgttctcactcataagtgggagctaagct
ATGAAGATGCAAAGGCGTAAGAATGACACAGTGGACTTTGAGGACTCAGGGGGAAAAG
gtgggaacggggtgagggataaaagactacaaattgagtgcagtgtatactgctcaggtg
atgggtgcaccaaaatctcacaaatcaaactaaagaacttactcatgtaaccaaacacca
cctgttccccaagaacctatggaaataaaaaaaaaaaaaaccagaagtaccattatccac

Exon  7 +      47870      47998   1   Internal    129    56    Marginal
agagaccaagtgtcacgggggtatgcaaacattgagtgcatagcagaatcattgaggtac
atctttgaaagctgtctaccagagttggtacatatatttagctttctttgttctcagcta
cagctttttctactagaccaaaccatctgatgtgtggctgtgaaacactaatatgctcag
TGTGGTGGGCTGAAGAATGGCCCTCCAAAGATGTTCATGATATAATCCCTAGAATCTGTG
AATACGTTACCTTAGATGGCATAGGAGATTTTGCAGATATGATGAAAGATTTTGTGATAG
ATTATCCAG
gtgagaccaatgtaatcacagggtccttagagaggcaggaggatctgagtcagagaagac
agatgtgacaatggaaacagagggaggaagaagaggtgatgaaggaaacagagggaggaa
ggagaggtgatgatggaaacagggaggagggagaggtgatgaaggaaatggaggagggag

Exon  8 +      49440      49564   1   Internal    125    78        Good
catggtttttagcagaggacactaaagcttccattttcaaagctggttgcttgttgttta
tttgtacctcaggagtggaaatactggctgagatgaaagtacctggcacaaatcgctttt
ccttcttggtgtttcacagccagatgttgcgaaattcttttgtttttcttttttctttag
TGCCTGGAAACCTTGGCTGCTACAAGGATCATGGAAACCCACCTCCTCTAACTGGCACCA
GTAAAACGTCCAACAAACTCACCATACAAACTTGCATCAGTTTTTGTCGGAGTCAGAGGT
TCAAG
gtgatgactctgtggctgtgtaactatagaaaaatataaagatgtaaatgcattttgctg
agataacttaaaaataagtgctaagtaaaataagccagacacaaaaggccacatattgta
tgattccacttacatgaattgtctagaataggcaaatccatagggatagaaagcaggtta

Exon  9 +      53346      53499   0   Internal    154    72        Good
gtacttattgttcagcttgaaattaagtgttgcaagagtggaagaagggggaggtcccag
gggaagggaccctgggaagttgaggctgattgcttgctggaagcccaccctgccaggctc
cttcaggccatctgacatccctgatgatgcttaccgtgtgctgcttctctgttgtggcag
TTTGCTGGGATGGAGTCAGGCTATGCTTGCTTCTGTGGAAACAATCCTGATTACTGGAAG
TACGGGGAGGCAGCCAGTACCGAATGCAACAGCGTCTGCTTCGGGGATCACACCCAACCC
TGTGGTGGCGATGGCAGGATCATCCTCTTTGATA
gtgagtatgccctgtgcccatcactgcccaaggcacaggaacccttggaccagagcaaca
agcctgcccaccctccctcccttctatgtattcattcattcacttggcaatagacaatac
ttgtgactagaccctgggaatacagcacagtgcatgaagactcagcccctgccttctgga

Exon 10 +      65425      65757   1   Internal    333    93   Excellent
tctccacagtcatttttcgagagtctcagcgattcgttttgtgactgtcaggttttacag
atagaaacaatgtcctaaatgggatcctgctcgttaggaaggctttagtgccttggtgtt
ggaagcgcgcctgtggcaaaggcccagactgagggcgtggtgtctttttctctcctacag
CTCTCGTGGGCGCCTGCGGTGGGAACTACTCAGCCATGTCTTCTGTGGTCTATTCCCCTG
ACTTCCCCGACACCTATGCCACGGGGAGGGTCTGCTACTGGACCATCCGGGTTCCGGGGG
CCTCCCACATCCACTTCAGCTTCCCCCTATTTGACATCAGGGACTCGGCGGACATGGTGG
AGCTTCTGGATGGCTACACCCACCGTGTCCTAGCCCGCTTCCACGGGAGGAGCCGCCCAC
CTCTGTCCTTCAACGTCTCTCTGGACTTCGTCATCTTGTATTTCTTCTCTGATCGCATCA
ATCAGGCCCAGGGATTTGCTGTTTTATACCAAG
gtaagacatctttgcctccttgggggttcttcagggcccacgtgccttgggcttctcttc
ttcacccttgtgacttgggcagttcttgcggggcagattgggcctcaggaactactgact
caacttgcagatcaccccgaggctgtggctccttccctacccccatttcataactcattt

Exon 11 +      66707      66865   1   Internal    159    94   Excellent
ttctaaagggtgacagcctgacaggttctgttttggggctggtgggacccacctatggaa
ggaattgcacccagaattgaatcagagaagaactcttcttcataactcgtgctctcctcc
cgcacaactctttgttgtctccatagccctgtccccagttaattgctttttctcttccag
CCGTCAAGGAAGAACTGCCACAGGAGAGGCCCGCTGTCAACCAGACGGTGGCCGAGGTGA
TCACGGAGCAGGCCAACCTCAGTGTCAGCGCTGCCCGGTCCTCCAAAGTCCTCTATGTCA
TCACCACCAGCCCCAGCCACCCACCTCAGACTGTCCCAG
gtagcaattcctgggcgccacccatgggggctggaagccacagagttgaaggtagcgctc
ttgacagttataaagacaaaagcacttgggtgtttcttattcagaggcaggttgggatac
tggctctgtgacctatagtctgtcctggcttttgagggaaattttcttattagcttggtt

Exon 12 +      68365      68449   1   Internal     85    99   Excellent
cctggggccccatgcttagcctgggtcagctgctcctgaggctaggtttgctagctgccc
tcccacaccggcctgcagggagcccctcagccagacttactcacttgggtattccagccg
acctcctttcgaaaaccaaccataaacaagtctggtaagctctgtcttttgcacttgcag
GATGGACAGTCTATGGTCTGGCAACTCTCCTCATCCTCACAGTCACAGCCATTGTAGCAA
AGATACTTCTGCACGTCACATTCAA
gtgagtacaagagggagctgcccaattccaggaaagggaaggctcagagttcattttcta
tgatgcttcatttgtctggttacaactgtagaataagcacatgattccaaagccctcagt
cctagggaacggaaggcagcagacattcccccttctttgtagagtgaaatgtacaactgg

Exon 13 +      76094      76212   2   Internal    119    66    Marginal
catcccagttccactgttcaccatgtgacctggggtgagtaacacggccctgtgtgcctg
ttttctcacctgtcaaatggagacagttatagtacctgcctttgtgaggcattgggctgt
atgaattattattacctgcagtatgttttccatcaaaggtagatgttcctttcattctag
AATAGAGGTGGGGGTTAAGAATGAGGAGGTGTCTGGGATGGTGCTCCGGTACCTGACATG
GGTGCCTGAGCGGAGAGAGGGGCCACTCTTCGACATAAGGAATGTAAAAGGAGCCAGGT
gtgagaggaaacctgatgagttcttttgggctaagtccactgcagtcgctgtgggacact
gaggcagagctgtccggcaggcattggacagacagcctgagccccccacaaggagcacag
ggctctgcacaacccaaggaaacatgggcaaaggtggcatcctcagggtgagtgttgggg

Exon 14 +      78875      78993   1   Internal    119    63    Marginal
gtttagtggacttgccttagttgctggtacctaagatagagattaagggccctcaagggg
tattcagacctcaaattcagccaaacacaggcgcagcttttcctgggtctgagtgagctg
aggaaagcacttttgaatgtgcaaggacaataagattaataaccactaccatctctgcag
TACGTACTGTGTACCAGACGCTGTGCCAAGTGACCAACAGACATTACCGAATTCATCTTT
GCCGCAACCCAACAAGGGAACTGAGGGTCAGAGAAGGGGTCCAGCCAGGGGCCGCCAAG
gttcggactcagcctgggaccactggctccaaagctgggggtccttactcctgttgagct
gcaggcccctccaacacaggcagtgggtgggcccccaaatagctcatcttcaaggatatg
gcctccggaaagcccagggaaagtgtggatcgattttcctgggtcaaggaagaatcaaac

Exon 15 +      82674      82809   0   Internal    136    60    Marginal
tcaggtaagggaacaaatgcagaatttgaatgtcctcatagttcccccaatgctgcaggt
ggacaaataggctaaggcccctggcccagctggcagaggtaaggagctgcccgcccgccc
agctcccgctgcggcagagcccccagccgccgcctcctgccgccctcgcctttcctgcag
GAGCCGTCCCAGCGCAGGCTTGCTCACCAGCGCCGCCCCGTGGTAAGACTGCAGATCTGC
GGAAGAAGGCCAGCCCTGAACCGCAACTGCTCTCAAGCCCTTCCATTACAGTTACACGGA
TTTTTTGCCCAGCGCG
gtgatgcgtgcctgtaatcccagctactctggaggctgagaggaaggatgccttgagccc
aggagttcagaatcagcctgggcaaaattgcgagagaaaagaaaaaagaaaaaaataatg
tcacaggtgtcctgactctaaacctggacattagcccaggtctcactctcaccaagccct

--------------------------------------------------------------------------------