--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (68922 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (22 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3654       3734   0   Terminal     81    49    Marginal
caatgtcataggcagcatttgcccacctcagacctcccaggccagccccctgggcccctc
cttccattcaaagctcctagttgggtaccagagggttgcccgcttgtagcctcttcccac
cagtccagtgggtgatggttaggcctagttcctgctcttccccaccttgtctttggacag
ATTGCCTCGGATGATGGCCTGCGACTGACAGTCTCTCAGCTCTTCTCAGCTCTCCTGAGG
CTGCAGCTGTCAGCTCCCTGA
tcctcagcacttgcctggaccagtgcgggtctgccacgccctgttcagccatccctgtcc
tgttgtgtcgtgcaagccacatctgtccacacccccaccacccaccagtgctggctctcc
tctcttctcccctgtgctcccagcatgcctcgtggccggtgccgtcagcagggccctcgc

Exon  2 +       3878       4083   2   Internal    206    68    Marginal
ctcagctctcctgaggctgcagctgtcagctccctgatcctcagcacttgcctggaccag
tgcgggtctgccacgccctgttcagccatccctgtcctgttgtgtcgtgcaagccacatc
tgtccacacccccaccacccaccagtgctggctctcctctcttctcccctgtgctcccag
CATGCCTCGTGGCCGGTGCCGTCAGCAGGGCCCTCGCATTCCCATCTGGGCAGCCGCCAA
TTATGCCAACGCACATCCATGGCAGCAGATGGACAAGGCGTCTCCTGGGGTGGCATACAC
CCCCCTTGTGGATCCCTGGATTGAGCGGCCCTGCTGTGGGGACACCGTGTGTGTGCGAAC
GACCATGGAGCAGAAGAGCACAGCTA
gtggcacttgtggcggtaaacctgcagaaaggggtcccctagctgggcacatgcccagct
cccgaccccacagggtggacttctgctgggtaccaggctcagacccaggcacctttgatg
gctccccgtggctactggaccgcttcttggcccagctgggcgattacatgtccttccact

Exon  3 +       4062       4511   0    Initial    450    85        Good
cctcgtggccggtgccgtcagcagggccctcgcattcccatctgggcagccgccaattat
gccaacgcacatccatggcagcagatggacaaggcgtctcctggggtggcatacaccccc
cttgtggatccctggattgagcggccctgctgtggggacaccgtgtgtgtgcgaacgacc
ATGGAGCAGAAGAGCACAGCTAGTGGCACTTGTGGCGGTAAACCTGCAGAAAGGGGTCCC
CTAGCTGGGCACATGCCCAGCTCCCGACCCCACAGGGTGGACTTCTGCTGGGTACCAGGC
TCAGACCCAGGCACCTTTGATGGCTCCCCGTGGCTACTGGACCGCTTCTTGGCCCAGCTG
GGCGATTACATGTCCTTCCACTTTGAGCACTATCAGGACAACATCAGCCGTGTCTGCGAG
ATCCTCAGGCGCCTAACAGGCCGAGCCCAGGCCTGGGCAGCCCCCTACCTTGATGGGGAC
CTGCCCCTGCCTGACGATTACGAGCTCTTCTGCCAGGATCTCAAGGAAGTTGTTCAAGAC
CCGAACAGTTTTGCTGAGTACCATGCTGTGGTTACCTGTCCCCTGCCCCTGGCCTCCAGC
CAGCTGCCAGTGGCCCCTCAGCTGCCTGTG
gtgaggcaatacttagctaggttcttagagggcctggcactcgacatgggtactgccccc
aggtctttaccagccgccatggccacccctgctgtgtctgggtccaactctgtatctaga
agtgctctgttcgagcagcagctgaccaaggagagcacccctgggcccaaggagccccca

Exon  4 +       4574       4691   2   Internal    118    58    Marginal
ccaggatctcaaggaagttgttcaagacccgaacagttttgctgagtaccatgctgtggt
tacctgtcccctgcccctggcctccagccagctgccagtggcccctcagctgcctgtggt
gaggcaatacttagctaggttcttagagggcctggcactcgacatgggtactgcccccag
GTCTTTACCAGCCGCCATGGCCACCCCTGCTGTGTCTGGGTCCAACTCTGTATCTAGAAG
TGCTCTGTTCGAGCAGCAGCTGACCAAGGAGAGCACCCCTGGGCCCAAGGAGCCCCCA
gtcctgcccagttctacatgtagctccaagcctggtcctgtggaaccagcctcttcccag
ccagaggaggcagcccccacacctgtccctagactgtcggagtcagctaatcctcctgcc
cagagaccagacccagctcatccaggaggtccaaaaccccagaaaacagaggaggaggtt

Exon  5 +       5467       5606   0   Internal    140    86        Good
atagttgcatcatctttgtcacctccacccccataaaacaccccccttggtgtcttccac
actggctgggactgaactgggtctgccacgtctgccctgttgggacctcgttcctgtatg
gggtttctgtgtctgtccccctagccccaccctctctgctccctgtgacttctgtcccag
CTGGAATGTGAGGAAGGCTGCCTGGAGGAAGTGGCCACTTTGATTCTGGGGGATGAGTGG
GATAGCATCTTGGCAAAGAATGATGTTTCCTGTGGGATTACCAGCAGTTCTGGGCAGCTG
GAAGGTTTGGATGCAGGAAG
gtgggatgcaagccccttgccaggctcagctgcaggcattcgccctttgtgtgttaacac
tgtagctctaatcgtgcctggtgttctgaagcaggctcctcttccctgctgctgtgctgc
catcccctgctcactccgcactcgcatgcattgcggattcagcacttaagccctagtgtg

Exon  6 +       8174       8309   0    Initial    136    50    Marginal
aactttaaaataggaagtactaaggataaggtcctatgggatattggaatattttataaa
gccacaatagttaaagcacttagatgtggacagatgagcagagaatagaggactttgaaa
cgggccaaataaatatggaaatttagtacaggctagaggtgtttccaattaacgagtaaa
ATGGATTATTCAGTAAAAGCAGTTGGCCCTCTGGAAAATAGTAAAGCCATGTATGTGCCT
CACTCTTTATGCCAGTACATATTCCAGATTAAAGATTTCAATGTTACAATTATGAAAGTA
CTAGAGGAAAATATGG
gtgaatttttttttttttttttttttgcctatgattccaggattttaaaagttttagatg
cccagagttgtggaggtatggagaagtggaccttctcatactgttggtgggaatacacaa
taatataatttgaccacgtaacaattctaggcacatgcatgctgtgactacttgctaggt

Exon  7 +       9125       9313   0     Single    189    41    Marginal
gacgacagcctacctggacatatttctccatgctcactgaggcaggggaaaggccacagc
aggccacaagtaatgtgtgtcaccccacttccatttctgtggccaaaggaagccacagag
ccacacctgagttccataggacggcagcagctgatcatcctatgggctggggtgctcagt
ATGGAGAAGTACAAGCAGCCACCCAGCGTGGGGCTGGTTGGTGCTGCTGAGGATGGGAGG
ATGGGAGGGGCCTGCATCCATCCCAGGGCAACATACCTGTTTGTCTGCTGGGGCTGCCTG
ACAAAGGACCGCAGGCTAGGGGACTTAAACAACAGACATTTCCTCATGATTCTGGAGCTA
GAAGCCTGA
gatcaaggtgtgggcagggttggtttctcctgaggcctcgctccttggcctgcagatagc
catcttcttgccgtgtccctgtctgtgtctgtgtcctaatctctcataagctcactagtc
tattggatcagggcccaccctcatgacctcatttaaccctgaattacctctttaaagacc

Exon  8 +      14172      14250   0    Initial     79    43    Marginal
tgtcttcctcaccaggaaggcaggggatgacactgaggtctctgctcaggacaggcctgt
ccagggagtgcctttctggttccaggtgtagcctgggaggtgcctgatgagcaggaggtg
ggagggagcccattcaccagccacctgtgtgcctgcctcaggcctcatggccttggcttc
ATGTTCTTGCTGGCCTGGAGGACCAGCCAATTCAACATCTTCATGCTAGAACGGCTGTGC
TACTTCATAGAGAAATTAG
gtgggctgggctggtgaagcgcaacagtggttagatcagtgctctttctgtccccagctg
gctggggacaccttctggaagtaacgatggtcataaaagtcatcagctcatttgcttaac
cgaataactactagcttgtaccagggggcactgttgatgaatttatattagggcaaaaat

Exon  9 +      15898      15996   2   Internal     99    96   Excellent
ctgctgtaaagtggctgtttttctctcctttccgtactctcctcttaggaagggagtcac
tgcataacccatatttaaacggttgggagttatctactcctccttgatggtagagtgtct
gcataaagtggaattcttctgtttgggagatttgtttatttagtcatttctttacctcag
TGTGGACTCATGGGCATTTTATTACGACACTAGCTCCCCTCTCATCTACACTTTTGCTGA
GGTTTCAGTTACCCATGGTCAATTGCAGTCTGAAAATAG
gtgagtacaatacaacaggatattgtaagagagagaccacattcacataacttttatcat
agtatactttttttttttttgaggcaagatcttgctgtgttgcctaggctgaagtgcagt
ggtgtgagcatagctcactgcagtctcaaactccacgggctcaagtgatcctaccacctc

Exon 10 +      24803      24857   2   Terminal     55    57    Marginal
gggtttcaccgtgttagtcagggtgatctcgatctcctgaccttgtgatcctcccgcctc
agcctcccaaagtgctgggattacaggcatgaaaaatttttatttttctatagtcagaat
tatccattttattttattgtttttttttttttttagatagagtcttactttctcacccag
ACTGGAGTGCAATGGCATGATCTGGGCCCACTGCAACTTTCGCCTCCTGGGTTAA
agcatttctcctgcctcagcctcccgagtagctgtacaaagattacaggtgcttgccacc
gcgcccagataattttgtatttttagtagagatggggttttaccatgttggccaggctgg
ttttgaactcctgacctcaagtctcggcctcccaaagtgctgggattacaggcgttgtat

Exon 11 +      28072      28125   1   Internal     54    70        Good
attgtttctgtttgccccatatacctttttgcccatctctaattttagcgttttggaatt
actttgtgttacactctttttcttattgagtgacatattctgagtcaaggagtaaattct
gagaatgaatccttgaacagatacgtgttgtgaacattttatttctgtctgtgtcttcag
TTTTGACTCCCTTCATGTCTCTTGATGAGAATTATGACTTTGAGCTTCATCCAT
gtaagactggagttgattcattttcagttctgtggagtattctatcgtacgaatttaccc
aatgtgttcctttctgcagttgctagccatttgggttgtttttggtttttgttattatac
ccaatactactaggaacattcttgtgtgagtttctttgtacacacttgtgagaatttctt

Exon 12 +      34765      34912   1   Internal    148    62    Marginal
ctctgtagccacaggccgttcatcagtgtctggggagcagtggcacctctctcccaggag
gggcacagggccagagacaatgagcaggggcaacatctcaagcacccctgtgcctgagca
gccttcctagagggtgagaatagggacgcagtcactcacacgccctcccttggtgcccag
GTAACTGCATCCTGCCCAGCATGACGGCCCCCTGCCCGCCGCCACCTCCAGACCCCCAGT
TTGTCCTCCGAGGCACCCAGTCACCGGTGCATGCGCTGCACTTCTGCGAAGGAGCCCAGG
CTCAGGGGCGCCCGCTCCTCTTCTCAGG
gtgagtagctgtggccccagccccaggccacccagggccaagtcaggaggtcgtgagcta
gcaaggagcccagcgcttgtttgagggtgctggccaaggggcatggactgctcgccaccc
aggcttgctgagctttcagcacccaccagcagacacactgtcccttgggggaggcaggga

Exon 13 +      40597      40704   2   Internal    108    55    Marginal
ggtagtcccagctacttgggaggctgaagtgggaggatcatctgagggaggagtttgagg
ctgcagtgagctgtgatcaccccactgcactccaccctgggcaacaaatcaagatattgt
ctcaaagaaaaaaaatgttaaagttcctggaaaaacaagtcagtcctccactccccgcag
GGCTTACATGGGTGCCCTCCATATGAGCGTGGTGTGCAGCCACACCTCCCCTCCCTTGGC
CCTGGCCCCTCCCCATGCTGAGGACACCCCCATCTCGGCCTCCCTGCA
gtgtcatgttgagccttgccgcctagcagagccacgggggctgtgcacgtctttgtgctc
caaatgtccaggtacattttgacatcagtttggcaggttctccaaaaccccagtggagat
ttggacgggaccgagttgcccagatcggcctttgtggtgctgaattctctgtggcgtggg

Exon 14 +      43693      43855   2   Internal    163    91   Excellent
tcaagtgtcaatgccagagcggtgaggcccttcctcagctgaggctcccgacctgcgatg
atccaagctcacggcacccactctctggaaacatggccttgccttccttccgctgcaggg
gccatgggagctgacacttgtcaaggggagtctcaggcctgtctcctctttgtctggcag
TCAGGGCCGGGACCTGAAGCTGTGCCTGTGGGACCTCGCGGAGGGCAGGAGCGCTGTCGT
GGACTCCGTGTGCTTGGAGAGTGTGGGCTTCTGCCGGAGCAGCATCCTGGCCGGGGGCCA
GCCACGCTGGACGCTTGCCGTGCCAGGGAGGGGCAGCGACGAG
gtgagagccagcctgcctgaggccccatgttctccaaacagttgtgctcatcctctgcat
ttgattaggaggcgcctgcgcctacccacaggactccatggagccgcccacctgccggca
gcttcagcagccggggctgatgcacagccggctaggcctgggcctgtccccttggggtgg

Exon 15 +      48019      48155   1   Internal    137    75        Good
ccctggtttctgggcttgatgggcaggaggctctatttgtgtgtgcaggtgtgtacatgt
tacccatgcatgtgtgtgtgcatgcgtttgtgtggggcctagatctgtgagccatccctg
gggctgagtggggctgaagccctgtgttggaggctgagctcctggtgctgagtggagcag
AAGCCCTGCTGTCAGAGGCTAAGCTCCTGGTGCTGAGTGGAGCAGAAGCCCTGCTGGCAG
AGGCTGAGCTGCTGTGGGGGCCCCTGGCAAGAGCAGCCTGCACAAGAAGCGCCGTGGCCC
TGGTCCGCGTACTGGAG
gtgggcgcctcagcaggtctctgtagctggaaggaccgggctgtgggcccagctctctgc
cctgcccggaggtgacctcagcacacccatagcatgcctgtggcagatctgggattcaga
cttggggtcccgggcctattctgtgtgggttagtgagggcagcaagcttctcacccacag

Exon 16 +      49383      49481   0   Internal     99   100   Excellent
gagagcgttttgcaagggcccatgcagcctaattaggagcctgggctcccaggtgcccac
ggggaggggagcagacagaaactcacagcagcccgggctaatcgccttaagagtctcttg
tttgtatagcgcagactcgacttggcgacggcccaaatcaacttgttttcttactgtcag
GTTCAGATTCTGGAGATGCCCTCCAAGACGTCAGTGTGCGCCCTGAAGCCGAAGGCAGAT
GCCAAGCTGGGCATGCCCATGTGCCTGCGGCTGTGGCAG
gtaaggccccgcgtgcaccagccacgccctgccggccacacccacggccatgagtcatgc
tccattcaggatctgatttatcgtcgagccactcaggcaacaccccacccccctgccgca
gggaacctgtgcagctgcctcagtgtccccacggccctctgcttcctgctgctgcaaggg

Exon 17 +      49383      49780   0   Internal    398    61    Marginal
gagagcgttttgcaagggcccatgcagcctaattaggagcctgggctcccaggtgcccac
ggggaggggagcagacagaaactcacagcagcccgggctaatcgccttaagagtctcttg
tttgtatagcgcagactcgacttggcgacggcccaaatcaacttgttttcttactgtcag
GTTCAGATTCTGGAGATGCCCTCCAAGACGTCAGTGTGCGCCCTGAAGCCGAAGGCAGAT
GCCAAGCTGGGCATGCCCATGTGCCTGCGGCTGTGGCAGGTAAGGCCCCGCGTGCACCAG
CCACGCCCTGCCGGCCACACCCACGGCCATGAGTCATGCTCCATTCAGGATCTGATTTAT
CGTCGAGCCACTCAGGCAACACCCCACCCCCCTGCCGCAGGGAACCTGTGCAGCTGCCTC
AGTGTCCCCACGGCCCTCTGCTTCCTGCTGCTGCAAGGGGCCTCCTGTCAGTGCCCCAGG
AGAGGCCTGGCTTCAGCCAGCAGCAGTGGCAGCAGGTCCTCGTCCTTTGCAAGCTCCGGT
GGGCTCACCCCGCAGCTCGTGGTGCCCTCCAGTGAGCG
gtgaggaggggacagtggggtctgccagcgcctcagtacttgggccgtgcttagggcagg
gcaggccacgctgactaactgcagcaagcctgcacggcccccgctttgcttaggattgat
ttttattacttctttgcctcttagaggcaggagtggacttaacacaatgacattccctga

Exon 18 +      53924      54159   0   Internal    236   100   Excellent
caggggctgtgtgggagggcactggcggtgcagagcttctgagctgtggcagccacgtgg
aagacatgggaaacagccccagccagcaggaggggcaggaatttccagagccccttctcc
cccgaaactcactggagtcagggtccttccaggagctgactgctctgctgttccccgcag
GCCGACTGCAGCTCCCGCCCACTCCTTCTGGCCGGCTATGAGGATGGATCGGTGGTCCTG
TGGGACGTCTCTGAGCAGAAGGTGTGCAGCCGCATCGCCTGCCATGAGGAGCCCGTCATG
GACCTTGACTTTGACTCCCAGAAGGCCAGGGGCATCTCAGGCTCCGCGGGGAAGGCGCTG
GCTGTCTGGAGCCTGGACTGGCAGCAGGCCCTGCAGGTCAGTGCGCCAGGCCCCGG
gtctcatttatcctgctctgcactaacagtctgataggctgaaacaatatttaggcatga
agaggagttgttgcagatccctggctaattaatcacttggaggcgggtgcaggggggctg
tccatggctggcgcaggaagaagggggcgtgggcgctggcagaccattcacatggtttgg

Exon 19 +      60112      60235   2   Terminal    124    81        Good
atttcctggtgaatgaggtcttttcttcattccccctcatcatctctagaaaggacattt
gccccaaagcctatttttccaactattaatatggctcagtccaggtttcttttggtcact
acttccctttatagcctttacattttaatcattttacctccaaccttcctggccctccag
GCGTAGACACATCTCTTATGGAGCCAGTTCTCACATCGATGATTGCATGTCGTGTGTGAG
CGTTGCCCTGGGTGTTCTTACATCTCAAGACCTCCTTCTGGAAGCCAAAAAGCGCATCCT
TTAG
ggattcctcaggcaggggcctcttggtggctgtgctggtggcctctgatgcacgggcctg
gatgctgaggggccgttctctgagcagcagcagctgctgggccatgggtctaggtcctgc
cacctccctgggctgctgagaattcagctcccagcctggccaccttccatgtgactcagt

Exon 20 +      63019      63238   0    Initial    220    75        Good
tcatttcagtattgagctttccagttctatattttctattatgactcttttttataattt
ccatttctctgctaagagttcctatttgctcactcaagacaattttttgggtaattattt
gaatacactttcctttcattttttttttgaaggaaaatttgtattattttaattatttta
ATGTACAGAAAACTCAACAGTGTACATTTAACCCAGTTTAGTGGCAAGTTCTTTAGCCTT
TGCCTTTTCGAGCTTGGCGATACGAGCCACAGACTTAGGACCCAGGATGTTGCCGCCCCA
GTGACGGCGGATCTCATCGTATCTGTCATTGTAATTGGTCCTGATAGCTTCCATCAGCTT
AGCCAAAGTGCCTTTGTCTTCCGAGTTCACCTATGTGAAG
gtgacagtggtgcaggtcttcctgtggactagacgtcccagtcttgccttccccttgata
atgcagtaagggacccccattttacgacacaaggcaggcaagaagacaaccagctcgatg
ggatccacgtcgtctgcaatcaccaccagctgagctttcttgttctccaccaaggtggtg

Exon 21 +      63336      63465   2   Internal    130    72        Good
cgtatctgtcattgtaattggtcctgatagcttccatcagcttagccaaagtgcctttgt
cttccgagttcacctatgtgaaggtgacagtggtgcaggtcttcctgtggactagacgtc
ccagtcttgccttccccttgataatgcagtaagggacccccattttacgacacaaggcag
GCAAGAAGACAACCAGCTCGATGGGATCCACGTCGTCTGCAATCACCACCAGCTGAGCTT
TCTTGTTCTCCACCAAGGTGGTGACGATGTTAACTCCTGCTCGAAGGACAGGTGGTCTCT
TGGTGGGGAC
gtcccgtttgccagcagctttcttctcagcccaggccaacagtctctgcttcttctcttg
ctttgtctctggtctgtacttgtgggccagcttaagcagctgagtagctgtttggcagtc
cagggcctaggtgaactggttaattgcaggaggcactttcagccgcttatagaggatggc

Exon 22 +      67180      67431   0   Terminal    252    98   Excellent
tggagtcccccatcgtggccttaggaagagtgggaggtcagctgggtaggagcgtgtggc
cctcacatcccgggcctgtgggcctgcgtctctcctggttccagctgcaggtggggcacc
aggggcagcactgccttgtgggcttaaggagtggcctaacacctctcccaactctcacag
GTGCGTGGGACTCATGAACTCACCAATCCCGGGATCGCCGAGGTCACGATCCGGCCAGAT
CGCAAGATCCTGGCCACCGCAGGCTGGGACCACCGCATCCGCGTGTTCCACTGGCGGACG
ATGCAGCCACTGGCCGTGCTGGCCTTCCACAGCGCCGCTGTCCAGTGCGTGGCCTTCACC
GCCGATGGCTTGCTGGCCGCGGGCTCCAAGGATCAGCGGATCAGCCTCTGGTCACTCTAC
CCACGCGCATGA
ctcacccactcccttcccgggagacgaggagggcgggcagggaggtgggcatcaggcccc
agccttggcctgaaacctcaagggcctctgaggaccagcaagtcatggcccaaggaccat
ggagtccccgctgtcttcatgaggttggtatttccttttgtggagtgcctcatcacagga

--------------------------------------------------------------------------------