--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (34626 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1244       1256   0    Initial     13    52    Marginal
ggacaagagttgcggacgcgaagaacgagtaagcggtggttcatccctcctgaccccacc
cccgtggcctggcccgatggtcgcgcccggggttgcgagatttgcgcctgcgcagtgcgg
cgcctagagggaaagcgagagggagacggacgttgagagaacgaggaggaaggagagaaa
ATGGCGTCCACGG
gtgagtatggtggaactgcggtcgcgccggcggtagccggaacgcccaaactgggggtcg
ttcgtctctgggcttggctgggaagactgagtggagttgccgagagggggttgaggcacc
cgccgcggcccgacgagctcggggatccgcattcctctcccctcccccaaccgggcgggc

Exon  2 +       2992       3060   0   Internal     69    70        Good
tgtgctgtactgtattagaattacagttgtggtttctgttgacacaaagtaaacacatta
ggcctggctgggggggccttcagagagtcacataagtaatctggtccttagtttcctttc
ctgtaaaatacagaagttaggctagacctcttaagcttttgagcccttctgaccttccag
CATAAGCATTCCACAAATTTGTCCTATGCTGACTTCAGCTCAGGTACTGTGAAGCTCAAC
TCAGGTAGT
gtgaagcagcttccatagtgactgctctaaagtgttaaaccgttgccttgggttaataat
agaagttttctctcctcgtatgttatctcatgtagaaaagtacgtaaagcatatatatcc
agtgcaacaaagaattggaatgcagactcgcagcaatctagaacccccagcgctcaatca

Exon  3 +       5123       5159   1   Internal     37    66    Marginal
tggtttagacttttttttctgttagatgttgagaggtaagggggactcatttggacctgt
gttggcaggtctccctacagtttaaagaattcttcctgccacgtgaattctttccccctt
ttttctcttctccttgtttctgctaactttacactatttttcctccttgttttcctctag
ATTACAGTACCTATAGCCAAGCTGCAGCGCAGCAGGG
gtaagtcagtcttttataaccgtattttgtgtgtgattaatattttttgaatatggagcc
ttctataattgtagaggtggtatttgaatgttctctattcaagttattgcatttaattct
tttgcagctacagtgcttacaccgcccagcccactcaaggatatgcacagaccacccagg

Exon  4 +       6648       6771   0   Internal    124   100   Excellent
agataagggataacattcatgatactgtgattatttgtcttgttttgttgtttttgtttt
gtttttttaatcttctagaaaggaatgtttttgattttggttctccaatttagtccattt
tattgctaaaatacaaaagttcatgtatgaagttcttgcattcgtttttttttggagcag
GCATATGGGCAACAAAGCTATGGAACCTATGGACAGCCCACTGATGTCAGCTATACCCAG
GCTCAGACCACTGCAACCTATGGGCAGACCGCCTATGCAACTTCTTATGGACAGCCTCCC
ACTG
gtaaggcctgccttggagagatttttgggtcgttctggctagggcattggctaagaagct
tattagtcatgctttcggatgtatattctggtccataccttggcatctggggaatccttt
attcttaggaagaggtattttttctctttcttccctactcttatagtcttgagagatctc

Exon  5 +      10937      11123   1   Internal    187    84        Good
attcagagaacttaggctttaaataccagtttgttgctactcttgcggaagggggaatat
ttaaagggattcaatatcctgatggtttaaagtaagtggtttacaaattgttctgataat
gagtgtctaggcagatctctgaggggacctgaaatctgatgcagctctcctttgttctag
GTTATACTACTCCAACTGCCCCCCAGGCATACAGCCAGCCTGTCCAGGGGTATGGCACTG
GTGCTTATGATACCACCACTGCTACAGTCACCACCACCCAGGCCTCCTATGCAGCTCAGT
CTGCATATGGCACTCAGCCTGCTTATCCAGCCTATGGGCAGCAGCCAGCAGCCACTGCAC
CTACAAG
gtaaggccatggtgtccttaatgcgtcagtcttatgttggagggaaagaaagcaactgtg
tacacttaaaataatctgtggtttagttccttattagtggttgctttcatatactctcag
atgttcactgttagtaactgatgtgctagaacataccacagaaatattctgcatttaaca

Exon  6 +      15297      15464   2   Internal    168    76        Good
gacactgagtttgatgtagtttactttaggattgtatttattattgtatttatttccagg
cttaatcataacattgcttattgctcgtagctttgtagcattcttacccaggagttttgt
ggttgaccaaccacacaaaaaaagtcactttttaattttatttattatttctcctcttag
ACCGCAGGATGGAAACAAGCCCACTGAGACTAGTCAACCTCAATCTAGCACAGGGGGTTA
CAACCAGCCCAGCCTAGGATATGGACAGAGTAACTACAGTTATCCCCAGGTACCTGGGAG
CTACCCCATGCAGCCAGTCACTGCACCTCCATCCTACCCTCCTACCAG
gtcagtctactttttgtggcaaaacaaaaacagtgacaaaacagtttttttcaggttgtt
gaccagcttgctttgacttcttcagctaaggtatgttatctgactgtcgcagtgataagt
catctgaccatacttggttacattaaagcctgagatctagggtcccatagtgttgcctgg

Exon  7 +      19830      20041   2   Internal    212    96   Excellent
ttattctgaacacaaaagtatttgctgagttgaaattcaaattgttgatgtgtagaaagt
aactactgttttatggatgtctgtgtcacatggtgtgaatgtctcttttattcaggggat
ttgaaataacaagcctctttctaaaaaagcttttttttttttctcttctctctctttcag
CTATTCCTCTACACAGCCGACTAGTTATGATCAGAGCAGTTACTCTCAGCAGAACACCTA
TGGGCAACCGAGCAGCTATGGACAGCAGAGTAGCTATGGTCAACAAAGCAGCTATGGGCA
GCAGCCTCCCACTAGTTACCCACCCCAAACTGGATCCTACAGCCAAGCTCCAAGTCAATA
TAGCCAACAGAGCAGCAGCTACGGGCAGCAGA
gtgagttgctaagagagaaaaccaaataagaatgaatgtgtttagagtttttttgtgggg
ttgattttttttgttggtttgtttttcttttgagatggagtttcactcttggggctgagg
ctggagtacagtggtgccatctcagctcactgcagcctccgcctcctggttcaagcaatt

Exon  8 +      21513      21662   1   Internal    150    60    Marginal
atccagcagttttgttgaacttaaaagagcctacctattaaggatgctttatcgtgatgt
aaagaagatggtgccttggttagtgccttggaattgaggattttgtgattccaggagaaa
gtacatcaggcagtggtgtaaatgctggtccatggcttacagatgtgactctttcctcag
GTTCATTCCGACAGGACCACCCCAGTAGCATGGGTGTTTATGGGCAGGAGTCTGGAGGAT
TTTCCGGACCAGGAGAGAACCGGAGCATGAGTGGCCCTGATAACCGGGGCAGGGGAAGAG
GGGGATTTGATCGTGGAGGCATGAGCAGAG
gtgggcggggaggaggacgcggtggaatggggtaagagcaaaccttttctccttttacct
aattttgtttcatccataggattttcagtggaaagaagggactgaaagacataagaaatt
aatttctgcatttccatggacaatctgttgagctcaagccatcttctaaaacatggaaat

Exon  9 +      24366      24506   0    Initial    141    76        Good
atctattttttcttgctaatttgccaagtattgcactattaataccagcccccgaaatga
aaggaaccaaccacactggtgtgtacaatcagacaagcaaggttgtatattgaggaaatt
tgagcaagctgccctgaagaaaggcatagtgacaagatgagagagatgcattgtttggag
ATGTGTTTAGCCAGTGCCCTTCTTCCCCACGAGCCCCCCCAAGGCTCAGAGCGGTACTGG
CTTTTAAAGGGAAAGGCCTTCATTTCTTCGTTTATCCCCCCAGCAGCGCTGGAGAGCGAG
GTGGCTTCAATAAGCCTGGTG
gtaagtttttgagtattaccatagatagtgtttaaaaaaaaatgcagtcagtttttagaa
aactataatttttttattagtttcataagtggtttaaaaatgatctatacaaaagagact
aatgggtactgccggcattgtcttaggggttaataaggttaacctatggttacaaaacaa

Exon 10 +      25407      25513   1   Internal    107    80        Good
cataattgccttaagtgaagtaaaccaaaagtttgatagcattcttcttagtatgcttgg
tagttttcttagatttatgatgaatatccttgggcagtagtgatcaggtagttaagaaac
ccctatagatacatgataataattctcctgtcttgttgtctctgaaaggcccacctgtag
ATCCAGATGAAGACTCTGACAACAGTGCAATTTATGTACAAGGATTAAATGACAGTGTGA
CTCTAGATGATCTGGCAGACTTCTTTAAGCAGTGTGGGGTTGTTAAG
gtcagtaaaagcataaccaggtcatctggcagaactttaaaccacagagcattttaaaga
gattgaattgatgttgagagttgttttctaaggttgcctttgcctgacttctttctaggt
atcttatggtttgttcctttttaaaaaagattagcctttttttttttttttttttgagac

Exon 11 +      29147      29386   0   Internal    240    91   Excellent
taaagcagggatagaggagaaaataacttagaattctgaaaaacttaaaagcggagaaac
ggtgacatttagtgacttactacatgtgagaaattggtacttttcctggattttgcctgg
acttttttctcccaaattagtatattctagtcatgcctaactatgctattctttgtctag
ATGAACAAGAGAACTGGGCAACCCATGATCCACATCTACCTGGACAAGGAAACAGGAAAG
CCCAAAGGCGATGCCACAGTGTCCTATGAAGACCCACCCACTGCCAAGGCTGCCGTGGAA
TGGTTTGATGGTGAGATGTACTCACTGGCATTCTTAATCTCCCTGGCTATAGAATATGGC
ATGAGGGAGAAACTTGTGAACCATAGGAGCAAGAAGACCTTCCATCTCTTCCTGGGGGAG

gtagatggccggtctccctgcagtagtagtagcacccagccattgaccctggatttggag
atccctttattttgaggcattagtattacaaatcaaccttgcttaaagtggcaaacactt
cctaagcacagattatcagaaggtacagaaaacccttcaaaagaacatcttagccagtgt

Exon 12 +      31457      31524   0   Internal     68    99   Excellent
ggtggtgcatgcctgtaatcccagctactcgggaggctgaggcaggagaattgtttgaat
ctgggggggtggaggttgcagtgagcaaagatcgtgccactgcactccagcctgggcaac
agtgtgagactccgtctccaaaaaaaaaaaaaaaaaattgtgggagctctgtttctgtag
AGCACGTGGAACACGCTCCTCACAGGGAAGGGGGCTGATGGCCTGAGCCACACGGAAACA
CGGGACAG
gtgatggggaaatgacagcagtagtatctgtgggtttacttagtgatttttatttcctat
agcaaatttggtgctacagagaaatgatttgctgtttcttgttgttcttgttgtaggtcc
aggaggcccaggaggtcctgggggacccatgggtcgcatgggaggccgtggaggagatag

Exon 13 +      31641      31793   0   Internal    153    89        Good
cgtggaacacgctcctcacagggaagggggctgatggcctgagccacacggaaacacggg
acaggtgatggggaaatgacagcagtagtatctgtgggtttacttagtgatttttatttc
ctatagcaaatttggtgctacagagaaatgatttgctgtttcttgttgttcttgttgtag
GTCCAGGAGGCCCAGGAGGTCCTGGGGGACCCATGGGTCGCATGGGAGGCCGTGGAGGAG
ATAGAGGAGGCTTCCCTCCAAGAGGACCCCGGGGTTCCCGAGGGAACCCCTCTGGAGGAG
GAAACGTCCAGCACCGAGCTGGAGACTGGCAGT
gtcccaatccgtatgtacttgtcttggcaaattgataccctacgagtgaagccacccttc
cctcaccccatccccactctagagtggattgctctgtctagaggaacagaatgatgaccc
tgatggctggttagggacactagtcagccattcactggacgcttcagagccttctgaaga

Exon 14 +      32507      32704   0   Terminal    198    88        Good
tctgcttaacaactttgagttgtcgtgtcctcatttctaaattgtcagcccgatgccgag
attgagtgaagtgtctggtttgttctgctgtgagagaaggaagcagagcagcttccacag
tgtccacagggcctctgcagccacccactgactgctttcgccctgctattctcaccttag
GTGGTGATCGTGGCAGAGGTGGCCCTGGTGGCATGCGGGGAGGAAGAGGTGGCCTCATGG
ATCGTGGTGGTCCCGGTGGAATGTTCAGAGGTGGCCGTGGTGGAGACAGAGGTGGCTTCC
GTGGTGGCCGGGGCATGGACCGAGGTGGCTTTGGTGGAGGAAGACGAGGTGGCCCTGGGG
GGCCCCCTGGACCTTTGA
tggaacagatgggaggaagaagaggaggacgtggaggacctggaaaaatggataagtaag
tgctggtgaaaagcagctgtgggccgccaggcacagtaagaggacagcccttcccagctt
ggttggcgcaagtcctcatgtctctaggaagcttgtgatagtggttgggaggagccagga

Exon 15 +      32713      32759   2   Internal     47    60    Marginal
ggtggcatgcggggaggaagaggtggcctcatggatcgtggtggtcccggtggaatgttc
agaggtggccgtggtggagacagaggtggcttccgtggtggccggggcatggaccgaggt
ggctttggtggaggaagacgaggtggccctggggggccccctggacctttgatggaacag
ATGGGAGGAAGAAGAGGAGGACGTGGAGGACCTGGAAAAATGGATAA
gtaagtgctggtgaaaagcagctgtgggccgccaggcacagtaagaggacagcccttccc
agcttggttggcgcaagtcctcatgtctctaggaagcttgtgatagtggttgggaggagc
caggaaggggcacctgggggctctggaagggcttcctcaccccttcccattctaaccgat

--------------------------------------------------------------------------------