--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8206 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        954       1044   0    Initial     91    57    Marginal
gtctcaccccgggggcggggaggacgcagacagaccccagcgccactgctcggccgcgga
tggtgccttagacccaggtcctgtgggctctggcccgagacccctgcctctggggaggcc
ggtgaccgggacagtccacctcgcaggcgcgccggcgcggagcccggacctcggcccgca
ATGACTCAGCAAGGGCCGGTGGGATTCTCCGTGGTCCTGCGATATCCAGACGGCGGAGTC
TCGCCTTTAATGTCGCGCGGGGAGCAGGCAG
gtgcgagcctgggctgagcaaaaccctccttggagtctccgcagaggagcggggcgcgcc
tcctgaataagcaggcggcggggcgcggggcagggcggggcaggcggccaggccctctcg
ggactgtcgtaaaagggggcggagcgcgccgcgcgtgggacaatcgtaaaaggggcggga

Exon  2 +       1298       1407   0    Initial    110    88        Good
ggcggcggggcgcggggcagggcggggcaggcggccaggccctctcgggactgtcgtaaa
agggggcggagcgcgccgcgcgtgggacaatcgtaaaaggggcgggacgcgccgcgctcg
ggatgtcgtgaagctgggggagctcgtcgccgccgccggcggctagcgggcgtccgcgcc
ATGGAGCGCTACGCGGCCGCCTTGGAGGAGGTGGCGGACGGTGCCCGGCAGCAGGAGCGA
CACTACCAGTTGCTGTCGGCGCTACAGAGCCTGGTGAAGGAGTTGCCCAG
gtacgcaggcggggcgggcggaggcctgcggaggcggcttcgtttcccgccggggctcac
cgcgcccccctacccgcagctctttccagcagcgcctgtcctacaccacgctcagcgacc
tggccctggcgcttctcgacggcaccgtgttcgaaatcgtgcaggggctactggagatcc

Exon  3 +       1487       1647   2   Internal    161   100   Excellent
tacgcggccgccttggaggaggtggcggacggtgcccggcagcaggagcgacactaccag
ttgctgtcggcgctacagagcctggtgaaggagttgcccaggtacgcaggcggggcgggc
ggaggcctgcggaggcggcttcgtttcccgccggggctcaccgcgcccccctacccgcag
CTCTTTCCAGCAGCGCCTGTCCTACACCACGCTCAGCGACCTGGCCCTGGCGCTTCTCGA
CGGCACCGTGTTCGAAATCGTGCAGGGGCTACTGGAGATCCAGCACCTCACCGAAAAGAG
CCTGTACAACCAGCGCCTGCGCCTACAGAACGAGCACCGAG
gtgcgcgggggcagcgggatgaggtgccgcctcctccgggtcggcgcctccgggcagctc
ttggtatctgtgcagatcagctccttccttggaagtgttcggaagaggtctctaagattg
acaaaatcaacgggcgcagagactgagacagcgcctttttggtgatcagtgggtccaacc

Exon  4 +       5067       5167   1   Internal    101    51    Marginal
caccagataagggcccggccctgggtgacagtggggtgggaggatggaggaggctggcat
cctccccactgcagacacccctttggcctggctgctctgctgggctggcaaggcaggtgc
ccatgggtgagggctgctgccgagtcccaccgcctgctgacgggctctcatccctcccag
TGCTCAGGCAGGCGCTGCGGCAGAAGCACCAGGAAGCCCAGCAGGCCTGCCGGCCCCACA
ACCTGCCTGTGGTTCAGGCGGCTCAGCAGCGAGAACTAGAG
gtactgggggcgcaggcagggtggccggcccagctctcctgtgggcaccacctggctctg
ctgactgggctgagctgaaggggtgtgggggctcaggcatgggtggctgtcctgggcctg
agtgggacactggaggcctagtgagtcccaccaggtggctcctctttgcggataccaagt

Exon  5 +       5810       5950   0   Internal    141   100   Excellent
cttcaggggttcacatggccgaggagaggcctgggtgtggtgaggatgcaccggtggtgt
cagagctgctgccactggggacggcagcaggagcatgtgtttgagctgccctcacctccc
cgccccctgatggcagagctgccctcacctctccccctccgcgccctggccccatggcag
GCCGTGGAACACCGGATCCGTGAGGAGCAGCGGGCGATGGACCAGAAGATCATCCTGGAG
CTGGACCGGAAGGTGGCTGACCAGCAGAGCACACTGGAGAAGGCGGGGGTGGCTGGCTTC
TACGTGACCACCAACCCACAG
gtcagtgcctgggcctgctctgccctagcccgagtgccccggggccccattccatctggg
gttttactgctggtccctggggagccaggctcagggtatgggggtgaagtggaaggattg
aggctctggaaaggatttctgtgccattcccagcacggaggccaggcccattccctacag

Exon  6 +       6462       6611   0   Terminal    150    63    Marginal
ggctcagattccgagtggccctgttgggggcagaagctcagattccaccctgtcctggca
ggccatgaccaggcttcacaggatggtcgcccccgtgggctcactgcctggcacccttgg
gccgggatgaaaggggcctgggggtcactctggccttcatggggcccctctgtatcccag
GAGCTGATGCTGCAGATGAACCTGCTGGAACTCATCCGAAAGCTGCAGCAGAGGGGCTGC
CGGGCAGGGAATGCAGCCCTGGGACTGGGAGGTCCCTGGCAGTCGCCTGCTGCCCAGTGT
GACCAGAAAGGCAGCCCTGTCCCACCATAG
ccacaggcagcagaagtctgggcagagttcatcttcttgacctttggccactgccttccc
agctgcccgcagggggttccccctgctgaggagagaccaggtggaccccagctgcctgtc
acccttcatctgggacttgctgtcaaaccctaggatagtctcataaaggggaggctgggc

--------------------------------------------------------------------------------