--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (9899 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2740       2814   0    Initial     75    65    Marginal
aggtgctcaatggatgtttgctgaatgactgaatgtcgatcataagttacagccacgccc
catgggcagcaaggctctgtagctcatcctggactccagtcacatcaacacctggcttct
cccgggtggatccagtgaaccattttcttttggtttgaagccagaggtgttcctggggag
ATGGCGGAACAGCACGGAGCACCCGAACAGGCTGCAGCTGGCAAGAGCCATGGAGACCTT
GGGGGCAGCTACAAG
gtactgggcagggagggggtcagagggcccaggctactcctgggcctcagggtcatcttc
ccagccaagcagcacctctgcaggaaggaagagccatccttccaaccacccaggccagga
caaaacgctccgggtgggtcctctcactgccaccctcccgttagaaacttgcttcatgac

Exon  2 +       4017       4135   0   Internal    119    99   Excellent
gttcctgaaggcgtttccctccatgaccattagagggcagtgcaggcccacctcagtgcc
agctccaggctggagagatgcagaaagcagagggtacctccctctaatgcccaaaggagg
ggcagaggctggagctgggagcctagcagaggtgggatgtttaggactctgctcttctag
GTGATCTTGTACGAACTAGAGAACTTCCAAGGCAAACGCTGCGAGCTCTCGGCCGAGTGC
CCCAGCCTGACCGACAGCCTGCTGGAGAAGGTGGGCTCCATCCAAGTGGAGTCCGGGCC
gtgagtacctagacccccagtccctcgccacagccctgagccttctgggagtgtggaggc
cccagtctgagctctagatctgttgtggggcttttgacagctcccctgccttctctggcc
tcgttttccgcatctgtaaaatgagagttgaagaattctctagaatcctagatgtctgca

Exon  3 +       4505       4803   1   Internal    299    74        Good
aggatacctgaggttggaagaacagcaaggtcaacctagcacctaactcagtgactggaa
catgggatttaatatttataattttaataataattgtaacacctaaaatttaacatgcat
tatgtcattgaatcgtcatgaccctgtgacagaggtatcattcttattcccactttatag
ATGGGGAAACTGAGGCCAAAGTTGGTAAGTGTCCCATCCATGTCCACAAGGCAGGCAGGT
CTCCCAGCTGGGCCCTGAATTCCCGCCTTTGGATTGCAAGTCCAGGCTCTGGCACTAACC
ATCTGGGTGATCTTCGGCAAGTTGCTTCACACACCAGGCCTCTGTTTTCTCATCTGTTGA
ATGGGGATAACAATGGTACGTACTTCAGAGAGAGTTTTTATGAAAATGAATGGAATGATG
CAAATAAATACATATTAATAACAATACAATACAAAGAAGAGGAAAAGGAAGAGGAAGAA
gtcactgtcacctatggaatacttactgtgtaccgggcattgtgctaaagacttttctgg
gtaccttgcacagaggctagattctcaataacataccctaggatggttttctggcccaga
gtctcagacagttcccggtatgtcctagcagctcctttaattacaggtccaggaattagc

Exon  4 +       5106       5247   2   Internal    142    90   Excellent
ctcagacagttcccggtatgtcctagcagctcctttaattacaggtccaggaattagcag
tagggttggagggagggtacaaggttcaaggtcagcagctcttggacacttctctcacta
aacttgaatccttcctcagctgcagcaaaggtgacccagccaagcctcttcctccctcag
GTGGCTGGCATTTGAGTCCAGGGCCTTCCGCGGGGAGCAGTTTGTTCTGGAGAAGGGGGA
TTATCCTCGCTGGGATGCCTGGTCCAACAGCCGTGATAGTGACAGCCTTCTGTCCCTCCG
GCCTCTGAATATTGTGAGTGTG
gttcctgctcacttctgggtgttcctggaagcagggtgcactgagagctggtcaggcagc
tcattgcacaagctgggctgagggtttggcccatatggacctggcctgggaagggccctc
atgtttctgatttgaacaattgtgtgggacaagaagtgggatattgaagggacattcggt

Exon  5 +       6563       6705   0   Internal    143    97   Excellent
ccgtccctcctacagtgaatttgggggtggaggcatctcctgaggcccttccctcctgca
gcaggtttgggggtgggtgttattttgtggtgacctgttgattctttccggcatctggag
cctccttgacctctgttctggatatgggagcagccgctcaccccacgatattgccctcag
GATAGTCCACATCACAAGCTGCATCTGTTTGAGAACCCAGCTTTCAGTGGCCGCAAGATG
GAGATAGTGGATGATGACGTGCCCAGCCTGTGGGCTCATGGCTTCCAGGACCGTGTGGCG
AGTGTCCGTGCCATCAACGGGAC
gtaagggacccaaccctcacccttgccccatcttctggtcagccatgcctctggctccaa
acagaatcagtgcccatagtttcttattattttatttatttatttatttatttttgagac
ggagtcttgctctgtcgcccaggctggagtgcagtggcgcgatctcagctcactgcaagc

Exon  6 +       8390       8555   2   Terminal    166    94   Excellent
gataaggctagagatgctttgttaagggtcctgtgagcagggtaaagagtttggattcat
cccaagggctctggggagctaaagaggaatgtaggcaggcagagtgcatggtcagatgct
ggctggaggcagggtgactggaagcagaccgtccacatctcaaccttggtctcccggcag
GTGGGTTGGCTATGAGTTCCCCGGCTACCGTGGGCGCCAGTACGTGTTTGAGCGGGGCGA
GTACCGCCACTGGAATGAGTGGGACGCCAGCCAGCCGCAGCTGCAGTCTGTGCGCCGCAT
CCGTGACCAGAAGTGGCACAAGCGGGGCCGCTTCCCCAGCAGCTGA
aaggcacccagacttcaaggacccagacccaccctggggggctgcaagggcaagaagagg
aggctccagggttggggcgagggccgacctgtccacccttccctggaatctgctcaataa
agcctggggttggtcccccacccgccacgttcctcggcatcacttcctgagggagccagg

--------------------------------------------------------------------------------