--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (35278 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        965       1093   0   Terminal    129    52    Marginal
gggccacctcggcccatcgggacctgtcagtccttgacctccctcaggcccctaggctgg
ccaggtcgcctcagtgccacgcctccctggcccgcgattcagcctgcacgttacgctttg
ttcccagaagcaggttttcgaaacgcggttccctctcggctccagctgttttcctgccag
CGCTGGGAGACCCGGCAGCCGCAGCGCCCCCAGCGGCGCGCAGCGGCCCAGGAAGAGAGT
GCCTACCGCCGGCGCCTCTTCAGCCTCCTCCTGGAACGCGGGAGCGGGCGCGACCAGCGC
CCACCCTGA
tcgtcgcgacggtgctcctgattggctgcgctgtgtgacgtaacgggagggccccggcgg
ccgccgggagccggggcccagcgcgtgcgcagacggagcgcgctgagcggagggggaggt
ggctgccgcttctcccgcgtccgccattttgttgctgtggctattgggaacaagctgggc

Exon  2 +       1710       2093   0    Initial    384    95   Excellent
gcgtcggaggatgctgcgggcccggagccgagaggaaagtgctggcccagccctctgagc
gctcctcgaggtgtgcgagaggcccttcctcggccccaaagccgtctgccgggctaaggc
gtgcagagcaggcgaggacagccgccgcccctaccgccgcagagtccccggtccaacacc
ATGTCCTCCGCCAGGTTCGACTCCTCGGACCGCTCCGCCTGGTATATGGGGCCGGTGTCT
CGCCAGGAGGCGCAGACCCGGCTCCAGGGCCAGCGCCACGGTATGTTCCTCGTCCGCGAT
TCTTCCACCTGCCCTGGGGACTATGTGCTGTCGGTGTCCGAGAACTCGCGGGTCTCCCAC
TACATCATCAACTCGCTGCCCAACCGCCGTTTTAAGATCGGGGACCAGGAATTTGACCAT
TTGCCGGCCCTGCTGGAGTTTTACAAGATCCACTACCTGGACACCACCACCCTCATCGAG
CCTGCGCCCAGGTACGCGAGAGCCCTCCCCGACCGCGGAGGAAGGTCGAGAACCGGGTCT
GTCGAAGAGTGCTTGTATAGGGGG
gtggggcgcgcttgaacccatattccccgcattctgaaccaaattattttccagaaggcc
ttcctaacagaaagctagtgtcaggatctgggtcactggataagaggatgcgtttttttt
ttttccctctcacgaggctgtttctcaatgtgaagaggatgcgttttgaatgtttaacgg

Exon  3 +       3669       3818   0     Single    150    53    Marginal
tacagtttttccagggttagatgtttatgactttatggatttgtcgaccgggtattactc
taaactttaaacattaaaagctattataattgaggacaccaactgtttgcatagtgggat
agagatagaaaaaaaaaagccatgacagtataatgactacaagattaactactgaactaa
ATGGACTTTAAAAGTGGGGAGAAAGTGATTATAAATCAAATACTGTATAACAAAGACCAG
GACACCAAGAATCTGATTGGTGAAACCTGCGGTTCCTGGCAGATGCTGGTAGTTGCAGTC
AACTTTGAGCACAATATAATTCCAATTTAA
ggagttgagaatcttagaacccactgtagtgagatttgtaatatgactgaataaattctt
cctctcgtttgtgagcgtgaattatataattaataccaggcattcattaagccatgcata
tgcttatgttgaggtcatgagtactaataatacagctgtttcaaaaagcaagttaatggg

Exon  4 +       4721       4768   0   Terminal     48    91   Excellent
tcactgactgccttaactacacctcactctccatctgttgaaatcctacctgttgttcca
gtcccctcacagattatagggcctttctctgaccctacccctcacgttcagctttgtttc
tccttctctgtgccctctgcctcaggcctgttgctttaatttagtttttcattttcctag
GTATCTCTGAAGGAGATCACCATGCTGGTTGAATTAGATCCTGACTGA
gtttactttgttatactgaatcttcgaattgccactcccaagcctggttttcatggctta
ggtttaacatgttattagccttttatagaaagctagtgactactagagcctgggccaaac
ggaaaactcagtgtaatgcttcttcgcatcccaaacagggtacatttagtggcttaactt

Exon  5 +      17570      18019   0    Initial    450    61    Marginal
ctaagatcacgctattgcactccagcctgggcgacaagagcaaaacttgtctcataaaaa
aggaaaataatttattatagaggagagtggtatattaagaagtttgacaggcactggctt
agagtaagatttttctcttagagtaattttctttctctcttaaggtatccaagcccacca
ATGGGATCTGTCTCAGCACCCAACCTGCCTACAGCAGAAGATAACCTGGAATATGTACGG
ACTCTGTATGATTTTCCTGGGAATGATGCCGAAGACCTGCCCTTTAAAAAGGGTGAGATC
CTAGTGATAATAGAGAAGCCTGAAGAACAGTGGTGGAGTGCCCGGAACAAGGATGGCCGG
GTTGGGATGATTCCTGTCCCTTATGTCGAAAAGCTTGTGAGATCCTCACCACACGGAAAG
CATGGAAATAGGAATTCCAACAGTTATGGGATCCCAGAACCTGCTCATGCATACGCTCAA
CCTCAGACCACAACTCCTCTACCTGCAGTTTCCGGTTCTCCTGGGGCAGCAATCACCCCT
TTGCCATCCACACAGAATGGACCTGTCTTTGCGAAAGCAATCCAGAAAAGAGTACCCTGT
GCTTATGACAAGACTGCCTTGGCATTAGAG
gtaaaatctgttcagattagctttttgggtcctttgacatttggttttaatttttagttt
tagtttagtttctgctcatttaagcttatattcatggaattagagcactggatgattttg
gaagatacgcactgttagcgtttcattttaaaatttttttatagagacgaggtctctaat

Exon  6 +      30209      30311   0   Internal    103    78        Good
aagtgccagatgccagtcagtagagtcatttcctggacaacactctggacaagtagggct
gtaggaaactattgccagcagcaagaggtaccctcttgccatttaactcttggtagacat
aaaagggctgactagtgtccctggcatatgtgttttagagttaatgtgtccactccccag
GTGCTAAGTGCGGCCAGCCACAAAGATAGTGTTTTGACAGTTCTAATAATGATTAGGATT
GGCCTGTTCCATAGAGTGAAAATTAATAAGGATGATGCATTAG
gtatgtgcttcctcttaatctgttgataaggtcagccacatctcccaggtgtagtttgcc
ccgtgaactgagttggtatctacccacatcaagattggtctgccctctaagactatactt
tcagggatcatttctatagttcattactagagaagtttctctgaaggtgtagagcacccc

Exon  7 +      30564      30708   0    Initial    145    70        Good
ttggtatctacccacatcaagattggtctgccctctaagactatactttcagggatcatt
tctatagttcattactagagaagtttctctgaaggtgtagagcacccctccctccaaaaa
aaaaaaacagattgatctgccctccacagtgagtgcttctttgagctggatccgtgtacc
ATGAACCCAGAGGAAGAGCACCACACCAGAATAGGGAGTGATGAGGGAAACGGCAAGATG
GCTGCCAAGCTACCAGCCATTTTAGGATCTGAGCACAAGCACTGTTTGGTAGAGCCATGG
AAGAAGCTGGTCCATAGCCAGGCCT
gtaactggacagcaggctgcataacagccaggatatctttactgtgttgagatagaaaac
agcatgaagaatgatgatggtgttttagcatgtggaaactcctgcaaggccacaatgagg
cactaatggtcaaggggccaccagaagtctctcagccattctcttcctaggctgctcttt

Exon  8 +      33486      33620   0   Terminal    135   100   Excellent
gttagaggttacattgagcagggatctcaccactacactccagcatggctaacagagtga
gaccctgtgtctaaataataatgtatgggccctttggataaggtagtgtttgtgatttaa
tgtaaactgtctttttcttgttgcagagaaatgctaactttgtcttcttcatccatacag
GTTGGTGACATCGTGAAAGTCACAAGGATGAATATAAATGGCCAGTGGGAAGGCGAAGTG
AACGGGCGCAAAGGGCTTTTCCCCTTTACGCACGTCAAAATCTTTGACCCTCAAAACCCA
GATGAAAACGAGTGA
ttgctgttgccctgtttcctgctgctttgttgttctgcctgtcctagtctcctttgaagt
gggaaagcattttctctcataggcaagtcacactgcattgccgaagtccagctttctgca
gactggcagtcgcacacacatttggaatgcacacagcggctgcctcctgatgtttgtatc

--------------------------------------------------------------------------------