--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (29621 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      17355      17422   1   Internal     68    71        Good
tcacagaggagggaatgtggacctcacgggggtctcatgagcttgcgagccgatggccag
gcagccggtgcagaaggttcatccattttgatgaaccgtgaattcatctgtactttattc
attttaataactgaatcatacctcattgtatggctctaccatgttttattatccattcag
GTGCTAACGGATGGAAGGGTTGTTTCTACCTGTTGGCCATTGTGGATGATGTTGCTATGC
ATATTGGG
gtacgagtatctggtttagtccctgttttcaattcttggtatacacctaggagtagaatt
gctgggtcatatggtagttctattttaacttttttttatttttaatttttgtgggttttt
aagaattttttaatatttgtgggtgcatagcatgtttaattttttttttttttttgagac

Exon  2 +      21942      22230   0   Internal    289    97   Excellent
gcacgagaaggctggctccctggcgctgacacgtcaggcaactgaggcacaaggctggca
tttctgaaccttgcccctctgcaaacacaagggggcgatggtggcactccaagcaaaggg
gcgtgtgggtgctgcaggaggagcacagagcactggcgcccctcccctcccgccctgcag
ATGCCGGAGGCCCCGCCTCTGCTGTTGGCAGCTGTGTTGCTGGGCCTGGTGCTGCTGGTG
GTGCTGCTGCTGCTTCTGAGGCACTGGGGCTGGGGCCTGTGCCTTATCGGCTGGAACGAG
TTCATCCTGCAGCCCATCCACAACCTGCTCATGGGTGACACCAAGGAGCAGCGCATCCTG
AACCACGTGCTGCAGCATGCGGAGCCCGGGAACGCACAGAGCGTGCTGGAGGCCATTGAC
ACCTACTGCGAGCAGAAGGAGTGGGCCATGAACGTGGGCGACAAGAAAG
gtggggtccgggccagcaggtgctcagctctgggacagggacccaggaccaggcatcaaa
gcccttacaggagaagctgttatcaccccatttccagggggctgggaaccctgggatatg
cccagatagggctggggggctcctctggagtcccagggtgccagggtccctgatgacccc

Exon  3 +      22981      23219   1   Internal    239    94   Excellent
ggacaccagggaggtgaaatacccctccagcgggtagggagggtgggcagaggagggcca
gcggccaggcatttgggaggggctcctgctctttgggagaggtggggggccgtgcctggg
gatccaagttcccctctctccacctgtgctcacctctcctccgtccccaaccctgcacag
GCAAGATCGTGGACGCCGTGATTCAGGAGCACCAGCCCTCCGTGCTGCTGGAGCTGGGGG
CCTACTGTGGCTACTCAGCTGTGCGCATGGCCCGCCTGCTGTCACCAGGGGCGAGGCTCA
TCACCATCGAGATCAACCCCGACTGTGCCGCCATCACCCAGCGGATGGTGGATTTCGCTG
GCGTGAAGGACAAGGTGTGCATGCCTGACCCGTTGTCAGACCTGGAAAAAGGGCCGGCT
gtgggcagggagggcatgcgcactttgtcctccccaccaggtgttcacaccacgttcact
gaaaacccactatcaccaggcccctcagtgcttcccagcctggggctgaggaaagacccc
cccagcagctcagtgagggtctcacagctctgggtaaactgccaaggtggcaccaggagg

Exon  4 +      23610      23767   0   Internal    158    98   Excellent
agaaccctaaagaaaactgatgaatgcttgtatgggtgtgtaaagatggcctcctgtctg
tgtgggcgtgggcactgacaggcgctgttgtataggtgtgtagggatggcctcctgtctg
tgaggacgtgggcactgacaggcgctgttccaggtcacccttgtggttggagcgtcccag
GACATCATCCCCCAGCTGAAGAAGAAGTATGATGTGGACACACTGGACATGGTCTTCCTC
GACCACTGGAAGGACCGGTACCTGCCGGACACGCTTCTCTTGGAGGTGAGCCCCAACCAG
GATGGCATCCGTGCCAGCTGCTGCCCAGAGCCCATTCA
gtcagcctcagcctctccaaagagccaggcattccagtagagccctgtgtggacacagct
cgctctggaggcaccacctgaggtctgggagtgtgggggactgaggaggccctgtggtgg
gtggagatgggtggggagctgggccaggggcctggctgggtggcctgttgggaactgggg

Exon  5 +      27951      28054   0   Internal    104    61    Marginal
cccaagtcttgtacagtcctttcctgcaggagtcacgctgggcagaaagtggaaacctgg
ccccaggggctaggcacaggcgtggtgccgtggcctagtgaggagcacccatcctggttt
ggggcaggttctctgggcacctctgaccctcacctcccccaccccccggtctgtttgcag
GAATGTGGCCTGCTGCGGAAGGGGACAGTGCTACTGGCTGACAACGTGATCTGCCCAGGT
GCGCCAGACTTCCTAGCACACGTGCGCGGGAGCAGCTGCTTTGA
gtgcacacactaccaatcgttcctggaatacagggaggtggtggacggcctggagaaggc
catctacaagggcccaggcagcgaagcagggccctgactgcccccccggcccccctctcg
ggctctctcacccagcctggtactgaaggtgccagacgtgctcctgctgaccttctgcgg

Exon  6 +      28088      28151   2   Terminal     64    78        Good
cacctctgaccctcacctcccccaccccccggtctgtttgcaggaatgtggcctgctgcg
gaaggggacagtgctactggctgacaacgtgatctgcccaggtgcgccagacttcctagc
acacgtgcgcgggagcagctgctttgagtgcacacactaccaatcgttcctggaatacag
GGAGGTGGTGGACGGCCTGGAGAAGGCCATCTACAAGGGCCCAGGCAGCGAAGCAGGGCC
CTGA
ctgcccccccggcccccctctcgggctctctcacccagcctggtactgaaggtgccagac
gtgctcctgctgaccttctgcggctccgggctgtgtcctaaatgcaaagcacacctcggc
cgaggcctgcgccctgacatgctaacctctctgaactgcaacactggattgttctttttt

Exon  7 +      28190      28321   2   Internal    132    67    Marginal
tgcgccagacttcctagcacacgtgcgcgggagcagctgctttgagtgcacacactacca
atcgttcctggaatacagggaggtggtggacggcctggagaaggccatctacaagggccc
aggcagcgaagcagggccctgactgcccccccggcccccctctcgggctctctcacccag
CCTGGTACTGAAGGTGCCAGACGTGCTCCTGCTGACCTTCTGCGGCTCCGGGCTGTGTCC
TAAATGCAAAGCACACCTCGGCCGAGGCCTGCGCCCTGACATGCTAACCTCTCTGAACTG
CAACACTGGATT
gttcttttttaagactcaatcatgacttctttactaacactggctagctatattatctta
tatactaatatcatgttttaaaaatataaaatagaaattaagaatctaaatatttagata
taactcgacttagtacatccttctcaactgccattcccctgctgcccttgacttgggcac

--------------------------------------------------------------------------------