--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (49288 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (22 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       7479       7532   2   Internal     54    77        Good
atgtgggggcaagaaggtacacatgagtgtgtggttatgagtcaggagcaccacgggatg
accttcagatcaggcatgacaaggtcctgcttagaggacggtctgggcttgtgtaccttt
atccggcagggacctacccagctggattgacctcactcatgccctctggtttccctgcag
GAGCCAGAGCCTGCAGGGTGGGTGTCGGGACATGCTGATCTTCCCTCAAGACAG
gtgagtggcctgggtttagcttggggacatcctctcccacataggacagcagagtgttct
ggtgggcctggcgggtgggggtgacagggatggactggccctggacactgtgtgctcctg
gtccttctcaccctgggtaggcacagcccctgggctggacagggtggatgtgagggcctc

Exon  2 +      16846      16955   0    Initial    110    62    Marginal
gtgcaagctcggggtctgcaggcccagccactcccacctgtctcagaggaacctcatgtg
ggatcagaggcagggggtcctgcagatcttggtgtcaggggcaggcttgacccggcctca
ggggtctcagagggggtctgccttgcccggtgtccaagacaggaatggagtctgcctagc
ATGCTGATCTTCACCAGGAGCCAAGATGTCCCCCACCCCCCAAAGGGCCTGTCGGGACTT
CTAGGTGGGATAAGCAGCAGCCATATGGGTGTGGACGAGTGTGCCTGCTG
gtgcgtgtgcctgtggggcagctgtgggtccctgtgcctgggtgtgcttgtgtgtgtgtc
tgtgtgtgtcttagttcattcacgctctgccaccaaataccttagatggagtcctttata
aacaacagaaacatactgttcacagtgctggaggctgggaagtccaagatcgaggcgcca

Exon  3 +      17084      17151   2   Internal     68    55    Marginal
ttctaggtgggataagcagcagccatatgggtgtggacgagtgtgcctgctggtgcgtgt
gcctgtggggcagctgtgggtccctgtgcctgggtgtgcttgtgtgtgtgtctgtgtgtg
tcttagttcattcacgctctgccaccaaataccttagatggagtcctttataaacaacag
AAACATACTGTTCACAGTGCTGGAGGCTGGGAAGTCCAAGATCGAGGCGCCAGCAGATTC
CGTGTCTG
gtgagggctattgatagatggcgctgtgtgtcctctcatggtggaaggggtaaaccagcc
ctcaagagccgctttgataaggacactgatcatataagggcactaatcacctcctaaagg
ccctacctcttaatactgtcacattggagattaggttttaatgtgaatttggggaacact

Exon  4 +      27175      27402   0   Internal    228    99   Excellent
cggccagcctcggattaatggcttttaatttagaatttaatcagtgtgcttccctctaga
gggctggatgctctggtctgggagtgagttgtatggtctgtgagtggggcgggcaggggc
ccatgatggccttgccaggctgtgccccaccccactgagcttactctgctttgcctgcag
CTGGCGGGCGCTCTGGTCATGGAGGACTGCAATGTGCACTCGGCCGCCAGCATCCTGGCC
TCGGTGAAGGAGCAGGAGGCCCGCTTCGAGAGGCTGACACGGGCACTGGAGCAGGAGCGG
CGCCATGTTGCCCTACAGCTGGAGCGTGCCCAGCAGCCTGGCATGGTCAGTGGTGGCATG
GGCAGTGGGCAGCCCCTGCCAATGGCCTGGCAACAGCTGGTCCTCCAG
gtaacagcctagtgacttgggaagggtgaaaattgccaagtgggaaaacaatcagtgggt
cctggtggaccacaagccagcatgcgctcgcttattgcaagatttgctggggctcctggg
gaggaaaggaaaatgggatcccaggttgggctggaagtcccacttgggtgtactaggcac

Exon  5 +      29416      29490   0   Terminal     75    47    Marginal
tgggctggccaggtttcccagattggtttcagtaggaagtgcctagcgatctacctgctg
agccacagggtcagagcccgggctttgggaagccagggcaatggcaaggcaggtagctgg
gggctgaggctggggaaccaggctagggggagtgctgctgcactcactgggctgctccag
GGTCCTGGCTACCTGCCCTTCATCTTCCAGCAGGAAGGGGCCCCTCCTCTAGACAGCCAG
CTGAAACAGGGCTGA
cgcccacccagtggggaggggtgccatcagggaacttgccttgggctcgtcttaggtgga
taggtggctggggcactagctgctggtgcagttgagaagatggagccagcttaaagataa
gatgcgggcgcgtttttggcgcagtgtctggtcttctgcgctctgctccaggggttccag

Exon  6 +      32415      32488   0    Initial     74    43    Marginal
cctgcagtctgttcttcaggacacagaccgtggtgcatctgtgaagtccggtggtttggg
tagataagtaatatgggaccagggcccagccacctgtgccccagcatccctctgtgtgtt
ggtccaatcttgcttttctgctccctgtgttccttgcattttgccacaaaagtgagactg
ATGCTACCCAGCACGTCCCACGACCCCAGCCCCCTCTGTCCTTCTCACCTCCTTGTGAAG
AAGCTGAGCCGAAG
gtgcgtgatggggcccagagcccctatgctgggctcagccctgtgttcccgggaccctct
tgtgagcaggggtaggtggtctacctccctggtcactctggcccctcccacaagcccaag
ggagctcatgggaaaccccaggcctgggcagcagcctgtttctgggccagtcctgggggc

Exon  7 +      35932      36054   0    Initial    123   100   Excellent
ggggtgggtgggttcaggaccaggaggaaggcaccctggtgtgctggccagcatgagctg
aggcagagctgctgtgtgtggagacctgcactccaggggtgactgagcagcaggcctgcc
caccaatgtccctccttgccccaggagcagagcccaggcagccaggcctcactggccacg
ATGCCGGAGGCACCTGATGTGCTGGAGGAGACCGTGACGGTGGAGGAGGACCCCGGCACA
CCCACTTCCCATGTGTCTATTGTCACATCCGAAGATGGCACAACCCGGCGCACCGAGACC
AAG
gtatggccaggcccaggcagtgggtgggtgagcagggccaggctgctgcagctgtcccac
ctgcagagtggacatggaagcttgccacgtggggcctctcattgctcgagtgggaaatta
aggccagccagaccccagcaaagcagtttctaggcctctcgtgctaccccacctacctgc

Exon  8 +      36250      36752   0   Internal    503    87        Good
ggcagtgggtgggtgagcagggccaggctgctgcagctgtcccacctgcagagtggacat
ggaagcttgccacgtggggcctctcattgctcgagtgggaaattaaggccagccagaccc
cagcaaagcagtttctaggcctctcgtgctaccccacctacctgcctatccatccaccag
GTCACCAAGACTGTCAAGACGGTGACCACTCGGACAGTACGCCAGGTGCCCGTGGGCCCA
GATGGACTCCCCCTGCTGGATGGCGGCCCCCCACTAGGCCCTTTTGCAGATGGTGCCCTG
GACCGGCATTTCCTGCTGCGTGGTGGTGGCCCAGTGGCCACACTCTCTCGAGCCTACCTC
AGCAGTGGGGGTGGCTTTCCCGAAGGCCCCGAGCCCCGGGACAGCCCCAGCTATGGCAGC
CTGTCCCGAGGGCTGGGCATGCGGCCCCCACGTGCTGGCCCCCTTGGCCCAGGCCCTGGT
GATGGCTGCTTCACACTGCCTGGCCACCGGGAAGCCTTCCCGGTGGGTCCTGAGCCTGGG
CCACCAGGTGGCCGCTCCCTGCCCGAGCGCTTCCAGGCAGAGCCGTATGGCTTGGAGGAT
GACACGCGCAGCCTGGCCGCTGATGACGAGGGTGGCCCTGAGCTGGAGCCTGACTATGGC
ACGGCCACAAGGAGGAGGCCTGA
gtgtgggcggggccttcataccaggtgagctgcaccccgtcccctgtggctacctcctct
gggaagtctgccctccaccccccaactacagagtgccccacttgtcaagtggcgcagttg
agttagtcatgcatgttagtttgaattggccttggctctcgtcagggacagaagaaaggt

Exon  9 +      37603      37647   0    Initial     45    53    Marginal
tagcagatgtctcacagaaacttgttttgctcgggattgggaaactgcccggtgacagca
gtgagtgagtttgctgtcctgggagggttgcctgggtcctggtagccgctggctggggtt
tggcatttggctctgaattggttctcactgggctggtgcatgactctctgtgtccccacc
ATGCTCCGGGCCAAGATACAGGTGCTCTCAGCCCAGCGCTGCTGG
gtgagtttgcagtcctgaagaaggtgtgatggggcagctcagaggcagggctggcggctg
ctgtgacgatgtccacgcgccccacttgcctgtgcagggcctacgaggacacagcagatg
atggcggcgagctggcggacgagcggcctgcgttcccaatggtgacggcgcccctggccc

Exon 10 +      37745      38244   2   Internal    500    97   Excellent
tctcactgggctggtgcatgactctctgtgtccccaccatgctccgggccaagatacagg
tgctctcagcccagcgctgctgggtgagtttgcagtcctgaagaaggtgtgatggggcag
ctcagaggcagggctggcggctgctgtgacgatgtccacgcgccccacttgcctgtgcag
GGCCTACGAGGACACAGCAGATGATGGCGGCGAGCTGGCGGACGAGCGGCCTGCGTTCCC
AATGGTGACGGCGCCCCTGGCCCAGCCTGAACGGGGCAGCATGGGCAGCCTGGACCGGCT
GGTGCGGCGCTCGCCCTCAGTGGATAGCGCCCGCAAGGAGCCGCGCTGGCGGGACCCTGA
GCTGCCTGAGGTGCTGGCCATGCTGCGGCACCCCGTGGACCCCGTGAAGGCCAATGCGGC
CGCCTACCTGCAGCATCTGTGCTTTGAGAACGAGGGTGTCAAGCGGCGTGTACGGCAGTT
GCGGGGGCTGCCGCTGCTTGTGGCACTGCTGGACCACCCGCGGGCTGAGGTGCGGCGCCG
GGCCTGTGGGGCACTGCGCAACCTCTCCTATGGCCGCGACACTGACAACAAGGCCGCCAT
CCGGGACTGCGGTGGTGTGCCTGCCCTGGTGCGCCTGCTGAGGGCTGCCCGGGACAACGA
GGTCCGTGAGCTTGTCACTG
gtgagtgggacctggccatgctcacatcccctgggaagagaagagtgtgaggctcaaccc
gggaggaacgaggccactcggcctgcgaccgcctgggaaagcacccggtaggcaggagtg
cagctgctgagacgcttgccccaggagccaggcatcaggcccagacactgtgacaggttc

Exon 11 +      38907      39090   1   Internal    184    86        Good
cttcctagctggaaaccagtactgggtgtcccccggaaccactcacggcttttgttactt
cctactgttctgcatgagctgggacatgaggagagtgggacaggtcctgagcgtggccac
ctggggaggtaggcaggcggtgcatatggtcagcacagattggccaatcgcaccccacag
GCACCCTGTGGAACCTGTCATCCTATGAGCCCCTGAAGATGGTCATCATTGACCATGGCC
TGCAGACGCTGACCCACGAGGTGATCGTGCCCCACTCAGGATGGGAGCGTGAGCCCAACG
AGGACTCCAAGCCACGGGACGCCGAGTGGACAACTGTCTTCAAGAACACGTCGGGCTGCC
TGAG
gtgtggaccagacctggtgctaaagcccacatgcacaccaggccccgtcctcgtggtccc
agatagtgtggaagatggcggcgagcttaggagcgccagagcttaggagcttcagagctg
tggcacaagtcctgtggatgagaagtggggcctgatggagctgtcctcacccccaagtgg

Exon 12 +      39912      40029   2   Internal    118   100   Excellent
cctgggggcagttagcttctcccccttcactgagctccagactgtggggtcctttcccat
tagtgctaggagggcagcagcagggcctattttgcagatgaagacaagcccacaaggcca
gggtggagccagggagtttctggtagccaggggtcacctggcctgctcttggccacacag
GAATGTGAGCTCCGATGGTGCTGAGGCCCGGCGGCGACTCCGGGAGTGTGAAGGGCTGGT
GGACGCGCTCCTGCATGCCCTGCAGTCGGCTGTGGGCCGGAAGGACACTGACAACAAG
gtgggcagggacggtcacagcctcataccaagggctggagagacgatcatgcaggtccca
ggaggctggaactgtgggagcagcacaggggaatgggcttgtgggtctggggtggcgttc
tgggtgtggcccgcctcgcagtgaccacactgaagtgggcaccgtcctgcaggcagaagg

Exon 13 +      40401      40572   0   Internal    172   100   Excellent
ggcagaggcttcctcccatggacccttcctggcggttaccgcccttttgctcccctccac
tgaggactccctgttcctttgctcccggtgccctcatgcacaccagctgtggccagtctt
tcctgagggccagccctgtgcctagggtgccctgccccacccactcacctctccctgcag
TCGGTGGAGAACTGCGTGTGCATCATGCGGAACCTGTCCTACCACGTGCACAAGGAGGTG
CCCGGGGCCGACAGGTACCAGGAGGCCGAGCCCGGGCCCCTGGGCAGTGCTGTAGGCTCC
CAGCGCCGGAGGCGGGATGATGCCAGCTGCTTTGGAGGCAAGAAGGCCAAAG
gtgggtggggcggactggggtatcatctctaccatctcaactcctgccccagcggaaggc
tctctgtacacccacagcagcccatcatggaggctagaggacacctggtcagcccccaac
aggcaggcagggaagccaggagtcaaggaggctggactgccctgggtcacatggttgatg

Exon 14 +      42230      42301   1   Internal     72   100   Excellent
acccctaggctaaactgtctgcccaaactctgacaacggtgctccactcccacaggtgcc
caggcctggacatgggggtgccttttggggcctgggtaggagagaactgtgcccaactct
cctgatacacccattccccatatggggtctgcctcacctcccaccacctttcccttccag
GAAAGAAGGATGGTGAGATGGACCGGAACTTTGACACGCTAGACCTGCCCAAGCGAACTG
AGGCCGCCAAAG
gtgagtgggctgagatgaagccagctccactgggggatgtctgggctcaggattgccctg
gtagtgaagctttgagccatcaagcaggcctggagggcctcagggaacagatggggaaac
aggcccctaggtgcaggatttcctggagggtgattcagcaccaggacacctgctgagggt

Exon 15 +      43748      43875   1   Internal    128   100   Excellent
tgggaacgcttttccccttgggtgactatatgttgatagtaaatattacgtgactcatcc
acacccatccctggccccagctcacccacgccctgggagctctgaagcgggaagcgggag
gggtatgatggatgagagcagattctgggtgaccgtgggtggcggttgccctgcacctag
GCTTTGAGCTGCTGTACCAGCCCGAGGTGGTACGTCTCTACCTCTCCCTCCTCACGGAGA
GCCGGAACTTCAACACCCTGGAGGCTGCCGCCGGCGCTCTGCAGAACCTCAGTGCCGGCA
ACTGGATG
gtgagggaccaggtcgggcagggtgggcaagtcctgagagagggaatcccaggcacctca
ctggtgcagctcctgcctcggctggcggggaaaggaggggccacaccaccaccccaggat
ccaagaggtgtatgggctgcgggcaatgcgtgcaccctggacggtgggaaaacctcggtg

Exon 16 +      44194      44344   0   Internal    151   100   Excellent
gcgggcaatgcgtgcaccctggacggtgggaaaacctcggtggaggtgccgttgagcttt
tggggtagggctttgtcgggcacgggagcaggaaggtccagctggagagagcggtcagcg
tctggaggtgggagagtgcctggcatgtatgtctgagcaaccctctccccgcctccgcag
TGGGCCACGTACATCCGCGCCACAGTGCGCAAAGAGCGCGGGCTGCCGGTGCTTGTGGAA
CTGCTGCAGTCTGAGACCGACAAGGTGGTGCGCGCCGTCGCCATCGCTCTGCGCAACCTC
TCGCTGGACCGGCGCAACAAAGACCTCATCG
gtgaggacgcctgcaaagcccacgcctgggcaccgaactgtgcctgcagctttggggtcc
catcggaggggcttggaggatgagtggtttgggagtccaggccccggccctctcgcttgg
gcgctgtcccaactggaggtagctccagtccccccggccctgtctctgaagctcagcgcc

Exon 17 +      44670      44908   1   Internal    239   100   Excellent
cagtccccccggccctgtctctgaagctcagcgccctgctcacaggggctcctgtgaccg
cctgcacacaggcggtctccaggggctctcctggcagtgcccctcgccctcgcgggatcc
ctgctccttcctggagaggtggggcagaggtgtgttctgacacctagtcctgcccctcag
GGAGCTACGCCATGGCTGAGCTTGTGCGGAATGTGCGCAATGCACAGGCTCCGCCGCGAC
CGGGGGCCTGCCTGGAGGAAGACACCGTGGTGGCGGTGCTCAACACCATCCACGAAATCG
TGTCCGACAGCCTGGATAACGCGCGCTCGCTCCTGCAGGCACGCGGGGTGCCAGCGTTGG
TGGCTCTCGTGGCCTCCAGGTGTGGAGGGGCGGGGTCGGTGGCTTGGGGAGCCGCGGAG
gtgggggaggggccaccactgaccccgcccccggccccacagccaatcggtacgcgaagc
gaaggcggcgtcacacgtgctgcagacagtgtggagctacaaggagctgcgtggtacctt
gcagaaagatggttggaccaaggcgcgcttccaggtgcggcttccctggccttccttcca

Exon 18 +      45160      45250   0   Internal     91    83        Good
cacacgtgctgcagacagtgtggagctacaaggagctgcgtggtaccttgcagaaagatg
gttggaccaaggcgcgcttccaggtgcggcttccctggccttccttccattccctgctca
ctttgccttattcccactccatgtgcttcacccaccctgtgtctgtgttttatgtctcag
TCAGCTGCTGCTACTGCCAAGGGGCCTAAGGGAGCACTGAGTCCTGGGGGCTTCGATGAC
AGCACGCTGCCACTGGTGGACAAGAGCCTTG
gtgagtggtggagcttagggagcctagagggtggcgaccccagctgccccagttgcctga
cccttgggtgaaggtgaaggaggagtcaggcctcccactgagacggcttccataggccac
tttccctgccctctgcctcttggctactcccttcccacagcatccgcgctgttgtcaagc

Exon 19 +      45576      45629   1   Internal     54    80        Good
actcccttcccacagcatccgcgctgttgtcaagctggggtgaggctgccagctggcaga
ggttgggcaccttagtgacagagagcctctagggctacctgggccagccctgtgtgggct
tctctgccccgatcccccctggctgccacatgcagcccgtctcctcctcctgccttgcag
AGGGCGAGAAAACTGGCAGCCGGGATGTGATCCCCATGGATGCGCTGGGCCCAG
gtgagtgcagatgcagtgtggttggttttctgtgccgggaggggaccaaggcctgaagtg
ggcctgctggttttatggggtgtagatggtgctgggtggaggagagatatttggtttagg
ggtgcttagagggtgaggtacagggcagctagagagggattagtgctcagccaggggctc

Exon 20 +      46016      46101   1   Internal     86    80        Good
agagttggcagggtgttggtgagagctggcaccagcctggatctccaggacagggtgggt
gggggctgtctcccaaagcccctgtcccacgagtcccctgtgtctgggctgagagggaga
tctgctcctacagggcctccctcagagcgcccctcatgccccaccttaccccatctacag
ACGGATACTCCACGGTGGACCGGAGGGAGCGGAGGCCACGGGGCGCCAGCTCTGCAGGAG
AGGCCTCTGAGAAGGAACCCTTGAAA
gtaagtggtcatgtggctgtgggcaggtccccggtgaggccccgtgtctaggggttgctg
gagagcagcctaggccatgctgggtctggtctgggccctggggtacagctgggttgtggg
gccaagcccaggaagcagccccttcacgccagtcagtctgtgggtactgacaagtttgca

Exon 21 +      46882      46938   0   Internal     57    84        Good
caggctggtggacgccgtaggggacgctaagcctcagcccgttgattcctgggtctagct
tgcatgcctggtacgttctctcatctggttgttcgtccacctgttcctgccctctgggcc
agggcttcttgttagtctccgctgcctgcacgctctgctcttcccgcacgttccccgcag
GACTTTGGCCTCCAGTCCAGCAGCCCAGTGGCCCATTCCCGGAAAGACCAGGCAGAG
gtcagagagggagggtgctccctgggcccacagccctgtcccaggcactgtgggatcagg
ggcctgaggaaatgggaccagagtagggatgggcaccataccctccaacgcccttcgggg
accagcaagtcaggatcagccctggtgccaagacccttggggtcagcccacaccacccag

Exon 22 +      49154      49216   2   Internal     63    54    Marginal
agattcttaatttctattttatatttttaaaacatgatattagtatataagataatatag
ctagccagtgttagtaaagaagtcatgattgagtcttaaaaaagaacaatccagtgttgc
agttcagagaggttagcatgtcagggcgcaggcctcggccgaggtgtgctttgcatttag
GACACAGCCCGGAGCCGCAGAAGGTCAGCAGGAGCACGTCTGGCACCTTCAGTACCAGGC
TGG
gtgagagagcccgagaggggggccgggggggcagtcagggccctgcttcgctgcctgggc
ccttgtagatggc
--------------------------------------------------------------------------------