Gene U2AF1 Variant 1
DNA : 14.57 KbNT_030188
mRNA : 898 bp NM_006758
CDS : 723 bp NP_006749
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  74 bp
ccgaaaaggcggagcctcccacgcgcactacgtgctccctacgcgcatgcgtcccgccca
cgcgcaggcagcacctcgcctgactgggtagcgctgccacgtcggggcggggaagagcgt
cgtcgcgtccgggtgacgtctcccgagggcgtcggcagggtcggcggcgtcggcagcagt
GTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTTCGGC
ACCGAGAAAGACAA
gtgagtgggagccccccgccgggggttgggcgcgatcggggcgcagggtggttgaggcgg
tgggagggcgaccggggaggcccaggcgggccggcgcggcggtggcgggggaggggcgcg
cggcgggaaggagcggtggcccttccggccccttgcgcgccctccggagccgccgcctcg
EXON 2  88 bp
tgaagttacgttgtcctaaaatacagcaaggaagaggaggtgcttaataccacggaaaaa
agtctgtgtcatgtttctgtgaggttaaaagtaatttgatagtgtatgtcatgctgctga
catattccatgtgtttgatatcttcccagcaaaataatcagctctcattttcccttacag
AGTCAACTGTTCATTTTATTTCAAAATTGGAGCATGTCGTCATGGAGACAGGTGCTCTCG
GTTGCACAATAAACCGACGTTTAGCCAG
gtttgtttgcctttttttcatgtaaattataaaaacttcatgttcttttcaaagacagtt
aatttctacatattaagcaagtcattttttctctcgtagttgtattttccatttgtgttc
ataagtgtgttcttttatttaaataatagtgaggcaggtgatcgacttccagtggaaggt
EXON 3  67 bp
tacaccgcagtgttagggattcaaggcagccgccaactgagaaaacgcctctgcttctcc
agaaaataacttgctctcttttcagcactgaatctcaactgaagcacttgccagaggcag
ccggttaagtgtttacctttaattttccataatataaagttgttgcgttttgtatttcag
ACCATTGCCCTCTTGAACATTTACCGTAACCCTCAAAACTCTTCCCAGTCTGCTGACGGT
TTGCGCT
gtaagttcatacaagttccttccccggttccctgggcttgcgtgtcagagctcagtgtcc
actccatctggtctgccgtgctagtgtcaaggaccgcgtttcactagaggtggcaaggag
ctttcgtcccactgaccccatggaaacctcttttggagatttgaactcccaccgtgtgtt
EXON 4  50 bp
acacttgacaccattcacaagtagccatgtggctcagtctcctgagtgctcctgcagagt
gcagctctgccaggcttttctctagataatctcgtgtgtgttactgtagcagtttgagtt
taaacacaagagttcactcggttaacatgttctaaccagcaagatttctgttgtttgcag
GTGCCGTGAGCGATGTGGAGATGCAGGAACACTATGATGAGTTTTTTGAG
gtgagagaactgaactctgtgactgatagacctgttgatcttctgtatctgtttggaagg
atttaaaatgtttctctgctaataaacatacatgagttatatctaatgacactttgtaat
gtataacgagtcttaaaccactgtggtctcccttcaggaggtttttacagaaatggagga
EXON 5  99 bp
aacactatgatgagttttttgaggtgagagaactgaactctgtgactgatagacctgttg
atcttctgtatctgtttggaaggatttaaaatgtttctctgctaataaacatacatgagt
tatatctaatgacactttgtaatgtataacgagtcttaaaccactgtggtctcccttcag
GAGGTTTTTACAGAAATGGAGGAGAAGTATGGGGAAGTAGAGGAGATGAACGTCTGTGAC
AACCTGGGAGACCACCTGGTGGGGAACGTGTACGTCAAG
gtaggagccagggcgagacggcggcgtggccgcttagtgtgccagggccaaggccaacag
gcgaaagcgagacagtggtgcagccgcttagtgtgccggggccaaggccgacagaggatg
gggtgcctgtcgccatgcaccttgagatcctggatgctcaggcgcacagcagggctcagg
EXON 6  134 bp
aatcttggactatcttgaagttaatctcattgaaaataaaggatttttcaattatcctgt
aatactattccaccttactatacctgagtgtgtatatctctctctgatatacttggattg
gtaattgagaaagtcttattaaagcgtggatggcaagcacttctgtttttgtcttttcag
TTTCGCCGTGAGGAAGATGCGGAAAAGGCTGTGATTGACTTGAATAACCGTTGGTTTAAT
GGACAGCCGATCCACGCCGAGCTGTCACCCGTGACGGACTTCAGAGAAGCCTGCTGCCGT
CAGTATGAGATGGG
gtgagtgaggagtggccagtgacgtgactgagcacagttcggggccgtgtgcacacgagg
tagtaaatgtctccttccaacccacccacagagaatgcacacgaggcggcttctgcaact
tcatgcatttgaagcccatttccagagagctgcggcgggagctgtatggccgccgtcgca
EXON 7  93 bp
aaccgttggtttaatggacagccgatccacgccgagctgtcacccgtgacggacttcaga
gaagcctgctgccgtcagtatgagatggggtgagtgaggagtggccagtgacgtgactga
gcacagttcggggccgtgtgcacacgaggtagtaaatgtctccttccaacccacccacag
AGAATGCACACGAGGCGGCTTCTGCAACTTCATGCATTTGAAGCCCATTTCCAGAGAGCT
GCGGCGGGAGCTGTATGGCCGCCGTCGCAAGAA
gtgagtattcctgtgcccgttgttaagctcagtggcttctttctcccctcacaaccctcc
cccttccaaaaaaaaaattttggcataggtgtcgtttctgttttttaaaaggcagtgctt
agaacatagtacatatttttaaatatccaaatgtcctctttggagaagaatattcacctg
EXON 8  293 bp
aaacttttcacacctgaaatcagggtgtgtctcagtcacggcgtgcagtctcttcagcag
tgtttttccttatcagtgccgttggcttgaggagctgcgcgtgttgagagagtgggtgtg
gttctgtgctgcgtgccgtggtttggatggcacggttttctttattttccttggttgcag
GCATAGATCAAGATCCCGATCCCGGGAGCGTCGTTCTCGGTCTAGAGACCGTGGTCGTGG
CGGTGGCGGTGGCGGTGGTGGAGGTGGCGGCGGACGGGAGCGTGACAGGAGGCGGTCGAG
AGATCGTGAAAGATCTGGGCGATTCTGAGCCATGCCATTTTTACCTTATGTCTGCTAGAA
AGTGTTGTAGTTGATTGACCAAACCAGTTCATAAGGGGAATTTTTTTTAAAAAACAACAA
AAAAAAAAACATACAAAGATGGGTTTCTGAATAAAATTTGTAGTGATAACAGT
attcttggtgtaacttatttcttgtggaagttctttaaatttctttttctttataaatct
gctagtcatcttggaggtaaagattaatatccatccaccactttgagtataaatgaaata
atattttttatcttagggcatgaaataaaacacataccaggtgagatctacatgctaaat