Gene TMPRSS3 Variant 4
DNA : 14.21 KbNT_030188
mRNA : 1341 bp NM_032405
CDS : 1035 bp NP_115781
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  150 bp
cttctgctatttccctgcttcctccgccctctcagagttacagggaatgacttagaaagg
tctctggtctccttggcattgtgataggtggaattctttcgtaggaaacacagccccggg
gttattttgatgcaagccgttggtccaaagccactccccactttgctatgtgggggaagg
ACCGGGCACCGGACGGCTCGGGTACTTTCGTTCTTAATTAGGTCATGCCCGTGTGAGCCA
GGAAAGGGCTGTGTTTATGGGAAGCCAGTAACACTGTGGCCTACTATCTCTTCCGTGGTG
CCATCTACATTTTTGGGACTCGGGAATTAT
gtgagtaccgaaactacttatgcttatggtaggtgtaccacacgcacagggaaagaattg
cgtttatgtgggacaggtgaaaacaatcgcaaaaaagcaatggaaagggctttgagagta
atttatcttctgaacaatagcaatatggcaacttctaaatggtgagagggagtccctcta
EXON 2  145 bp
gttatctgctgtagctcagacgaaaatgcattctcaccagatgactgtttttggttaatc
gatactgaatgcgctttgtgtggactgtcgaatttcaaagatttaccgtatgaccaagat
gcacctgatgctacaagtataaataggggaacaaatgctttctgttcttcctcggctaag
GAGGTAGAGGTGGAGGCGGAGCCGGATGTCAGAGGTCCTGAAATAGTCACCATGGGGGAA
AATGATCCGCCTGCTGTTGAAGCCCCCTTCTCATTCCGATCGCTTTTTGGCCTTGATGAT
TTGAAAATAAGTCCTGTTGCACCAG
gtaagtggacccaggtgaggactctgtgatttctgcccataccctcatgtaggtgaccaa
tgtgactgactgtccctgtgggggaaatatctccccagccattctgacacccacaggctg
gacacctgcacttccctagatctgcagaatctcagggagaaggggcattggagaggggat
EXON 3  111 bp
aggactgaactagagaatgtgccccttggtgggtggccctttccctaattaaggcacctt
tctttgggctgagacttctctgcaaagaggggagggggaaaggatagttaaatttgtaag
tttcatggcactccaagtcaggttctgtggctttctgctcttcctttttctggttttcag
ATGCAGATGCTGTTGCTGCACAGATCCTGTCACTGCTGCCATTGAAGTTTTTTCCAATCA
TCGTCATTGGGATCATTGCATTGATATTAGCACTGGCCATTGGTCTGGGCA
gtgagtacaattcattatttagtaggatctcaaatacctagccaagtagttaaactttca
tgagcgccccctctcatcccagcattttgctgctgcccagccttaattactggaggcaaa
catccttttggtttgctgacttgaagttttatttgcccacatgaatgtaaagtcagtctg
EXON 4  117 bp
accccttggaattcaaaacagaaactgggctgcaggaaacaggctgctgacagggacgca
atttcaatacaggtttcattattcacgggccagctccgcactgtgtggcagggggacagt
tgttagtgttgcactctgaaagagctgttggttaattcctgccttcctcccttttcccag
TCCACTTCGACTGCTCAGGGAAGTACAGATGTCGCTCATCCTTTAAGTGTATCGAGCTGA
TAGCTCGATGTGACGGAGTCTCGGATTGCAAAGACGGGGAGGACGAGTACCGCTGTG
gtaaggtcatggctcttcccctggggaaacagaaggaagcagcagaagccaaccctgacc
cttcccatctgtaaaatgggtccaagtcattgccatttttaggtcatgtcttcagctggg
attgaactggcgtttgcccaaagacatgttgggctggggggtcagggagggccttccatg
EXON 5  124 bp
agaccagcgagaagtctcagggatccagagtcactgctctgtgatggggaggctgccgtg
gacaagaagtgggtcagatttggcagaggaggggtttgagctggctgtggagaaacccct
gcctatggtctcagggttccactggccactaataagcctttctttctgcacatcggccag
TCCGGGTGGGTGGTCAGAATGCCGTGCTCCAGGTGTTCACAGCTGCTTCGTGGAAGACCA
TGTGCTCCGATGACTGGAAGGGTCACTACGCAAATGTTGCCTGTGCCCAACTGGGTTTCC
CAAG
gtaagttaaagagcatttccaacccatgggcaaaacacagagaggataacaataaagaaa
gacaactaccatttagttgggcactattgggtgctttaacgctctcagattacatcctca
catccaccttaggatgcccgatatcatcctcacttcacaggcaagcaaaccaaggccaga
EXON 6  126 bp
gaatgccttgccagggtgagtgaacttcattctcttggcaaaggaagcctttgatgggtt
tggggggacaaaatgacatcccccatgtacaatccctgtaatattgtgactcgcacatcg
gttgaatgcttcaaagtgtaaagttaccacgtcgggtctgtctttccaatgtgcttgcag
CTATGTGAGTTCAGATAACCTCAGAGTGAGCTCGCTGGAGGGGCAGTTCCGGGAGGAGTT
TGTGTCCATCGATCACCTCTTGCCAGATGACAAGGTGACTGCATTACACCACTCAGTATA
TGTGAG
gtaggtggtcaggcgatgctgttgtctgcacaggtatcgagtcacctgctggatttgtga
tgctatgcacaactccacaaggacttaagaggcatgcatgtgttatctcagatggaaggt
gggagttggccaccttgatgagactggtggatgcgccaggctgggggtgtgagaacctga
EXON 7  44 bp
attgtgtgacctcatcctcatggttttttttttttttgaacatagactaaaattgtaatc
tatattcaaagagggggaaatagaatttatttttctgttaccctaagattgagtttttaa
gagtgttcctttcacagatctggggcatttttcacagagcctactttttctccgctttag
GGAGGGATGTGCCTCTGGCCACGTGGTTACCTTGCAGTGCACAG
gtaagagttccagaaaggcaggggtccagggggagcaagcacatgctaagtcctatctcc
ttgccctcagagtcctctccccccatggggctctgtatcccttcctcctgggtgccaggc
gggaactctgtgtacccctacctgctggaggaggggagcagtgtcatcctcacctgtcgg
EXON 8  166 bp
caagagcctgaccacctcccctgctgagctcccccttgcagcacttgtcttagagctgct
gtgagctctgggagcaggggcagtgagggtggggagagaggagcaggtgcatggtggtga
caccatgtcccccaaagaagtctgcagggtggacccacaagcctttgttcccctccatag
CCTGTGGTCATAGAAGGGGCTACAGCTCACGCATCGTGGGTGGAAACATGTCCTTGCTCT
CGCAGTGGCCCTGGCAGGCCAGCCTTCAGTTCCAGGGCTACCACCTGTGCGGGGGCTCTG
TCATCACGCCCCTGTGGATCATCACTGCTGCACACTGTGTTTATGA
gtgagtgctgctgaccatcttcccagacccctgttcactcctgggtcatgtcagggtggg
gctgctttgggtggtgagaagcgggtccagagggaagacagagagactaacctccaagta
atgtacagttggagaggagtctccagcctcactgtggacccatcatcatcagctgggggt
EXON 9  358 bp
tgtgtttctgtagggcgtggcagtgcagttgcatatacagcataaacaagcagggtgatg
ggaccacatcttgcctgataacctctcccaccatcttcctaggttttcaggatacctgag
gtcaatgagttcagtggttggacttttcctgtgcttcacctcttgctcttctcatttcag
CTTGTACCTCCCCAAGTCATGGACCATCCAGGTGGGTCTAGTTTCCCTGTTGGACAATCC
AGCCCCATCCCACTTGGTGGAGAAGATTGTCTACCACAGCAAGTACAAGCCAAAGAGGCT
GGGCAATGACATCGCCCTTATGAAGCTGGCCGGGCCACTCACGTTCAATGGTACATCTGG
GTCTCTATGTGGTTCTGCAGCTCTTCCTTTGTTTCAAGAGGATTTGCAATTGCTCATTGA
AGCATTCTTATGATGGCTGCTTTATAATCCTTGTCAGATATTAATAATTCCAACTCCTGA
TTCATGTTGGTGTTGGCATCAGTTGATTATCTTTTCTCATTAAAATTGTGATGCTCCT
agctcttggtatgacaagtgattttcaattgtatcctggacaatgtggctctcatgtttg
cagacttgagtcctacctacattttcaatgttaccctgtttaaatgtagtttgtagatcc
tggcctacagaatgaatgcactgatgactctgccaggtagattggtgggctgtagttcca