Gene TMPRSS3 Variant 3
DNA : 17.23 KbNT_030188
mRNA : 2104 bp NM_032404
CDS : 984 bp NP_115780
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  190 bp
agtctaaattcaccttgcactgtggttcctgggccaggccacatagcgagataaagtggg
gcacagcagccccaccccttggaattcaaaacagaaactgggctgcaggaaacaggctgc
tgacagggacgcaatttcaatacaggtttcattattcacgggccagctccgcactgtgtg
GCAGGGGGACAGTTGTTAGTGTTGCACTCTGAAAGAGCTGTTGGTTAATTCCTGCCTTCC
TCCCTTTTCCCAGTCCACTTCGACTGCTCAGGGAAGTACAGATGTCGCTCATCCTTTAAG
TGTATCGAGCTGATAGCTCGATGTGACGGAGTCTCGGATTGCAAAGACGGGGAGGACGAG
TACCGCTGTG
gtaaggtcatggctcttcccctggggaaacagaaggaagcagcagaagccaaccctgacc
cttcccatctgtaaaatgggtccaagtcattgccatttttaggtcatgtcttcagctggg
attgaactggcgtttgcccaaagacatgttgggctggggggtcagggagggccttccatg
EXON 2  124 bp
agaccagcgagaagtctcagggatccagagtcactgctctgtgatggggaggctgccgtg
gacaagaagtgggtcagatttggcagaggaggggtttgagctggctgtggagaaacccct
gcctatggtctcagggttccactggccactaataagcctttctttctgcacatcggccag
TCCGGGTGGGTGGTCAGAATGCCGTGCTCCAGGTGTTCACAGCTGCTTCGTGGAAGACCA
TGTGCTCCGATGACTGGAAGGGTCACTACGCAAATGTTGCCTGTGCCCAACTGGGTTTCC
CAAG
gtaagttaaagagcatttccaacccatgggcaaaacacagagaggataacaataaagaaa
gacaactaccatttagttgggcactattgggtgctttaacgctctcagattacatcctca
catccaccttaggatgcccgatatcatcctcacttcacaggcaagcaaaccaaggccaga
EXON 3  126 bp
gaatgccttgccagggtgagtgaacttcattctcttggcaaaggaagcctttgatgggtt
tggggggacaaaatgacatcccccatgtacaatccctgtaatattgtgactcgcacatcg
gttgaatgcttcaaagtgtaaagttaccacgtcgggtctgtctttccaatgtgcttgcag
CTATGTGAGTTCAGATAACCTCAGAGTGAGCTCGCTGGAGGGGCAGTTCCGGGAGGAGTT
TGTGTCCATCGATCACCTCTTGCCAGATGACAAGGTGACTGCATTACACCACTCAGTATA
TGTGAG
gtaggtggtcaggcgatgctgttgtctgcacaggtatcgagtcacctgctggatttgtga
tgctatgcacaactccacaaggacttaagaggcatgcatgtgttatctcagatggaaggt
gggagttggccaccttgatgagactggtggatgcgccaggctgggggtgtgagaacctga
EXON 4  44 bp
attgtgtgacctcatcctcatggttttttttttttttgaacatagactaaaattgtaatc
tatattcaaagagggggaaatagaatttatttttctgttaccctaagattgagtttttaa
gagtgttcctttcacagatctggggcatttttcacagagcctactttttctccgctttag
GGAGGGATGTGCCTCTGGCCACGTGGTTACCTTGCAGTGCACAG
gtaagagttccagaaaggcaggggtccagggggagcaagcacatgctaagtcctatctcc
ttgccctcagagtcctctccccccatggggctctgtatcccttcctcctgggtgccaggc
gggaactctgtgtacccctacctgctggaggaggggagcagtgtcatcctcacctgtcgg
EXON 5  166 bp
caagagcctgaccacctcccctgctgagctcccccttgcagcacttgtcttagagctgct
gtgagctctgggagcaggggcagtgagggtggggagagaggagcaggtgcatggtggtga
caccatgtcccccaaagaagtctgcagggtggacccacaagcctttgttcccctccatag
CCTGTGGTCATAGAAGGGGCTACAGCTCACGCATCGTGGGTGGAAACATGTCCTTGCTCT
CGCAGTGGCCCTGGCAGGCCAGCCTTCAGTTCCAGGGCTACCACCTGTGCGGGGGCTCTG
TCATCACGCCCCTGTGGATCATCACTGCTGCACACTGTGTTTATGA
gtgagtgctgctgaccatcttcccagacccctgttcactcctgggtcatgtcagggtggg
gctgctttgggtggtgagaagcgggtccagagggaagacagagagactaacctccaagta
atgtacagttggagaggagtctccagcctcactgtggacccatcatcatcagctgggggt
EXON 6  170 bp
tgtgtttctgtagggcgtggcagtgcagttgcatatacagcataaacaagcagggtgatg
ggaccacatcttgcctgataacctctcccaccatcttcctaggttttcaggatacctgag
gtcaatgagttcagtggttggacttttcctgtgcttcacctcttgctcttctcatttcag
CTTGTACCTCCCCAAGTCATGGACCATCCAGGTGGGTCTAGTTTCCCTGTTGGACAATCC
AGCCCCATCCCACTTGGTGGAGAAGATTGTCTACCACAGCAAGTACAAGCCAAAGAGGCT
GGGCAATGACATCGCCCTTATGAAGCTGGCCGGGCCACTCACGTTCAATG
gtacatctgggtctctatgtggttctgcagctcttcctttgtttcaagaggatttgcaat
tgctcattgaagcattcttatgatggctgctttataatccttgtcagatattaataattc
caactcctgattcatgttggtgttggcatcagttgattatcttttctcattaaaattgtg
EXON 7  96 bp
ggtgtggtggatggggtaaggggctcctgctgtgagctgatcgttttcaagtaaccaagg
gcttgaccttccttcccttgggagatagtttgggctcctcagaggcagaagcatagatga
gattgttttctcggactcctgcttcaattgagttgtgaactattgtttcccttcaagcag
AAATGATCCAGCCTGTGTGCCTGCCCAACTCTGAAGAGAACTTCCCCGATGGAAAAGTGT
GCTGGACGTCAGGATGGGGGGCCACAGAGGATGGAG
gtcagtgggctgaagccaagattcggagtccaggggctcagaacccagagggctgcggag
ggggctcccccaatgtcccattgtgatgttcccatgggctgcccagataccccggccagg
gagtgcatgtcagctgctcgggacacagtcagccaaggaactgtgggtcaggagtcacgg
EXON 8  146 bp
cttcgagacagtgggagtctgctcgtcccacccgcagggccctgtccttttccgctgttg
cgacacaccagagagcatccccctcgtccctcgttccctcacccccctggtctcagcatg
cgccttctgtgttttgggccgggcttccttctcacacacatcccctcactcactttgaag
CAGGTGACGCCTCCCCTGTCCTGAACCACGCGGCCGTCCCTTTGATTTCCAACAAGATCT
GCAACCACAGGGACGTGTACGGTGGCATCATCTCCCCCTCCATGCTCTGCGCGGGCTACC
TGACGGGTGGCGTGGACAGCTGCCAG
gtacggggccgcagcggtgggcgaggccgtggcagggtgacccagcccttgggacaggtc
gttgccagcgtttccctgtgacaggacaaaaagtaaatttacagggcgtggagaagaaat
ttgctcaagatatcactccttttcctggctgccagccctgtgtttacccagtgatctggc
EXON 9  153 bp
gggatgctgtgtctggaagggctggtgggttcccttctgtaacctgggtcatccattggg
acatcatgaaggggggtcccaactccatagcaagcagcctcacacggcagactgtccaca
gaaagcaatctcgcatggcggtgactgtcccccaatctttgcttctttcctgtcacccag
GGGGACAGCGGGGGGCCCCTGGTGTGTCAAGAGAGGAGGCTGTGGAAGTTAGTGGGAGCG
ACCAGCTTTGGCATCGGCTGCGCAGAGGTGAACAAGCCTGGGGTGTACACCCGTGTCACC
TCCTTCCTGGACTGGATCCACGAGCAGATGGAG
gtgggtgcggcgccctccccagctcacgttgtccctggcttttgaccctaaggtccctta
aatgcaaccctggtcttgctataaaaaccagggcgtgacccagtggttgtcaattcagca
gcagtgacttggtggctccagggtgtcagacgcttgtgctgaaaacagagatcacagcta
EXON 10  889 bp
ttcatgcctgcctgggatccactcagagctggcagccccagggggaggccaaccttgtct
tcatcgtggagaacagccccacaattcccacagggcaaaatgcaggtgcccgctccgtca
tcatgttggacggatggctggaagtgctaaaaacaataacgcctttgttttcatttatag
AGAGACCTAAAAACCTGAAGAGGAAGGGGACAAGTAGCCACCTGAGTTCCTGAGGTGATG
AAGACAGCCCGATCCTCCCCTGGACTCCCGTGTAGGAACCTGCACACGAGCAGACACCCT
TGGAGCTCTGAGTTCCGGCACCAGTAGCAGGCCCGAAAGAGGCACCCTTCCATCTGATTC
CAGCACAACCTTCAAGCTGCTTTTTGTTTTTTGTTTTTTTGAGATGGAGTCTCGCTCTGT
TGCCCAGGCTGGAGTGCAGTGGCGAAATCCCTGCTCACTGCAGCCTCCGCTTCCCTGGTT
CAAGCGATTCTCTTGCCTCAGCTTCCCCAGTAGCTGGGACCACAGGTGCCCGCCACCACA
CCCAACTAATTTTTGTATTTTTAGTAGAGACAGGGTTTCACCATGTTGGCCAGGCTGCTC
TCAAACCCCTGACCTCAAATGATGTGCCTGCTTCAGCCTCCCACAGTGCTGGGATTACAG
GCATGGGCCACCACGCCTAGCCTCACGCTCCTTTCTGATCTTCACTAAGAACAAAAGAAG
CAGCAACTTGCAAGGGCGGCCTTTCCCACTGGTCCATCTGGTTTTCTCTCCAGGGGTCTT
GCAAAATTCCTGACGAGATAAGCAGTTATGTGACCTCACGTGCAAAGCCACCAACAGCCA
CTCAGAAAAGACGCACCAGCCCAGAAGTGCAGAACTGCAGTCACTGCACGTTTTCATCTC
TAGGGACCAGAACCAAACCCACCCTTTCTACTTCCAAGACTTATTTTCACATGTGGGGAG
GTTAATCTAGGAATGACTCGTTTAAGGCCTATTTTCATGATTTCTTTGTAGCATTTGGTG
CTTGACGTATTATTGTCCTTTGATTCCAAATAATATGTTTCCTTCCCTC
attgtctggcgtgtctgcgtggactggtgacgtgaatcaaaatcatccactgaattccag
gggctccattactgtcatctctcctgtgtgcgttgtggacttggcattcttctgtcggaa
caggttgctcagcagatcagcatcagctcgtgtcatacacagaactcaaaagtagagcaa