Gene TMPRSS3 Variant 2
DNA : 18.53 KbNT_030188
mRNA : 2523 bp NM_032401
CDS : 1791 bp NP_115777
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  492 bp
ctgccatcatgcccagctaatttttgtatttttaatagagatggggtttcaccatgttgg
ccaggcttgtcttgaactcctgacttcaggtgatccacccgctttggcttcccaaaatgt
tgggattacaggagtgagccactgcacccggctgttttccccctttttataagggcaaca
GCCACGTTGGATTAGGGCCCACCCTAATGACTCATTTTAACTAGATGACTCTGTAAAGAC
TCTCCAGGCCATCTCCAAATAAGATGCCATTCTGAGGTACTAAGAGTTAAGACCTCAACG
TGTCTTTCTGGGGGATACTATTCAACCCATAGCACATCCCCTCATCCCCCATGGAATAAC
CGGGTCAGAGGTGGAGCAGGTAGGACTGAACTAGAGAATGTGCCCCTTGGTGGGTGGCCC
TTTCCCTAATTAAGGCACCTTTCTTTGGGCTGAGACTTCTCTGCAAAGAGGGGAGGGGGA
AAGGATAGTTAAATTTGTAAGTTTCATGGCACTCCAAGTCAGGTTCTGTGGCTTTCTGCT
CTTCCTTTTTCTGGTTTTCAGATGCAGATGCTGTTGCTGCACAGATCCTGTCACTGCTGC
CATTGAAGTTTTTTCCAATCATCGTCATTGGGATCATTGCATTGATATTAGCACTGGCCA
TTGGTCTGGGCA
gtgagtacaattcattatttagtaggatctcaaatacctagccaagtagttaaactttca
tgagcgccccctctcatcccagcattttgctgctgcccagccttaattactggaggcaaa
catccttttggtttgctgacttgaagttttatttgcccacatgaatgtaaagtcagtctg
EXON 2  117 bp
accccttggaattcaaaacagaaactgggctgcaggaaacaggctgctgacagggacgca
atttcaatacaggtttcattattcacgggccagctccgcactgtgtggcagggggacagt
tgttagtgttgcactctgaaagagctgttggttaattcctgccttcctcccttttcccag
TCCACTTCGACTGCTCAGGGAAGTACAGATGTCGCTCATCCTTTAAGTGTATCGAGCTGA
TAGCTCGATGTGACGGAGTCTCGGATTGCAAAGACGGGGAGGACGAGTACCGCTGTG
gtaaggtcatggctcttcccctggggaaacagaaggaagcagcagaagccaaccctgacc
cttcccatctgtaaaatgggtccaagtcattgccatttttaggtcatgtcttcagctggg
attgaactggcgtttgcccaaagacatgttgggctggggggtcagggagggccttccatg
EXON 3  124 bp
agaccagcgagaagtctcagggatccagagtcactgctctgtgatggggaggctgccgtg
gacaagaagtgggtcagatttggcagaggaggggtttgagctggctgtggagaaacccct
gcctatggtctcagggttccactggccactaataagcctttctttctgcacatcggccag
TCCGGGTGGGTGGTCAGAATGCCGTGCTCCAGGTGTTCACAGCTGCTTCGTGGAAGACCA
TGTGCTCCGATGACTGGAAGGGTCACTACGCAAATGTTGCCTGTGCCCAACTGGGTTTCC
CAAG
gtaagttaaagagcatttccaacccatgggcaaaacacagagaggataacaataaagaaa
gacaactaccatttagttgggcactattgggtgctttaacgctctcagattacatcctca
catccaccttaggatgcccgatatcatcctcacttcacaggcaagcaaaccaaggccaga
EXON 4  126 bp
gaatgccttgccagggtgagtgaacttcattctcttggcaaaggaagcctttgatgggtt
tggggggacaaaatgacatcccccatgtacaatccctgtaatattgtgactcgcacatcg
gttgaatgcttcaaagtgtaaagttaccacgtcgggtctgtctttccaatgtgcttgcag
CTATGTGAGTTCAGATAACCTCAGAGTGAGCTCGCTGGAGGGGCAGTTCCGGGAGGAGTT
TGTGTCCATCGATCACCTCTTGCCAGATGACAAGGTGACTGCATTACACCACTCAGTATA
TGTGAG
gtaggtggtcaggcgatgctgttgtctgcacaggtatcgagtcacctgctggatttgtga
tgctatgcacaactccacaaggacttaagaggcatgcatgtgttatctcagatggaaggt
gggagttggccaccttgatgagactggtggatgcgccaggctgggggtgtgagaacctga
EXON 5  44 bp
attgtgtgacctcatcctcatggttttttttttttttgaacatagactaaaattgtaatc
tatattcaaagagggggaaatagaatttatttttctgttaccctaagattgagtttttaa
gagtgttcctttcacagatctggggcatttttcacagagcctactttttctccgctttag
GGAGGGATGTGCCTCTGGCCACGTGGTTACCTTGCAGTGCACAG
gtaagagttccagaaaggcaggggtccagggggagcaagcacatgctaagtcctatctcc
ttgccctcagagtcctctccccccatggggctctgtatcccttcctcctgggtgccaggc
gggaactctgtgtacccctacctgctggaggaggggagcagtgtcatcctcacctgtcgg
EXON 6  166 bp
caagagcctgaccacctcccctgctgagctcccccttgcagcacttgtcttagagctgct
gtgagctctgggagcaggggcagtgagggtggggagagaggagcaggtgcatggtggtga
caccatgtcccccaaagaagtctgcagggtggacccacaagcctttgttcccctccatag
CCTGTGGTCATAGAAGGGGCTACAGCTCACGCATCGTGGGTGGAAACATGTCCTTGCTCT
CGCAGTGGCCCTGGCAGGCCAGCCTTCAGTTCCAGGGCTACCACCTGTGCGGGGGCTCTG
TCATCACGCCCCTGTGGATCATCACTGCTGCACACTGTGTTTATGA
gtgagtgctgctgaccatcttcccagacccctgttcactcctgggtcatgtcagggtggg
gctgctttgggtggtgagaagcgggtccagagggaagacagagagactaacctccaagta
atgtacagttggagaggagtctccagcctcactgtggacccatcatcatcagctgggggt
EXON 7  170 bp
tgtgtttctgtagggcgtggcagtgcagttgcatatacagcataaacaagcagggtgatg
ggaccacatcttgcctgataacctctcccaccatcttcctaggttttcaggatacctgag
gtcaatgagttcagtggttggacttttcctgtgcttcacctcttgctcttctcatttcag
CTTGTACCTCCCCAAGTCATGGACCATCCAGGTGGGTCTAGTTTCCCTGTTGGACAATCC
AGCCCCATCCCACTTGGTGGAGAAGATTGTCTACCACAGCAAGTACAAGCCAAAGAGGCT
GGGCAATGACATCGCCCTTATGAAGCTGGCCGGGCCACTCACGTTCAATG
gtacatctgggtctctatgtggttctgcagctcttcctttgtttcaagaggatttgcaat
tgctcattgaagcattcttatgatggctgctttataatccttgtcagatattaataattc
caactcctgattcatgttggtgttggcatcagttgattatcttttctcattaaaattgtg
EXON 8  96 bp
ggtgtggtggatggggtaaggggctcctgctgtgagctgatcgttttcaagtaaccaagg
gcttgaccttccttcccttgggagatagtttgggctcctcagaggcagaagcatagatga
gattgttttctcggactcctgcttcaattgagttgtgaactattgtttcccttcaagcag
AAATGATCCAGCCTGTGTGCCTGCCCAACTCTGAAGAGAACTTCCCCGATGGAAAAGTGT
GCTGGACGTCAGGATGGGGGGCCACAGAGGATGGAG
gtcagtgggctgaagccaagattcggagtccaggggctcagaacccagagggctgcggag
ggggctcccccaatgtcccattgtgatgttcccatgggctgcccagataccccggccagg
gagtgcatgtcagctgctcgggacacagtcagccaaggaactgtgggtcaggagtcacgg
EXON 9  146 bp
cttcgagacagtgggagtctgctcgtcccacccgcagggccctgtccttttccgctgttg
cgacacaccagagagcatccccctcgtccctcgttccctcacccccctggtctcagcatg
cgccttctgtgttttgggccgggcttccttctcacacacatcccctcactcactttgaag
CAGGTGACGCCTCCCCTGTCCTGAACCACGCGGCCGTCCCTTTGATTTCCAACAAGATCT
GCAACCACAGGGACGTGTACGGTGGCATCATCTCCCCCTCCATGCTCTGCGCGGGCTACC
TGACGGGTGGCGTGGACAGCTGCCAG
gtacggggccgcagcggtgggcgaggccgtggcagggtgacccagcccttgggacaggtc
gttgccagcgtttccctgtgacaggacaaaaagtaaatttacagggcgtggagaagaaat
ttgctcaagatatcactccttttcctggctgccagccctgtgtttacccagtgatctggc
EXON 10  153 bp
gggatgctgtgtctggaagggctggtgggttcccttctgtaacctgggtcatccattggg
acatcatgaaggggggtcccaactccatagcaagcagcctcacacggcagactgtccaca
gaaagcaatctcgcatggcggtgactgtcccccaatctttgcttctttcctgtcacccag
GGGGACAGCGGGGGGCCCCTGGTGTGTCAAGAGAGGAGGCTGTGGAAGTTAGTGGGAGCG
ACCAGCTTTGGCATCGGCTGCGCAGAGGTGAACAAGCCTGGGGTGTACACCCGTGTCACC
TCCTTCCTGGACTGGATCCACGAGCAGATGGAG
gtgggtgcggcgccctccccagctcacgttgtccctggcttttgaccctaaggtccctta
aatgcaaccctggtcttgctataaaaaccagggcgtgacccagtggttgtcaattcagca
gcagtgacttggtggctccagggtgtcagacgcttgtgctgaaaacagagatcacagcta
EXON 11  889 bp
ttcatgcctgcctgggatccactcagagctggcagccccagggggaggccaaccttgtct
tcatcgtggagaacagccccacaattcccacagggcaaaatgcaggtgcccgctccgtca
tcatgttggacggatggctggaagtgctaaaaacaataacgcctttgttttcatttatag
AGAGACCTAAAAACCTGAAGAGGAAGGGGACAAGTAGCCACCTGAGTTCCTGAGGTGATG
AAGACAGCCCGATCCTCCCCTGGACTCCCGTGTAGGAACCTGCACACGAGCAGACACCCT
TGGAGCTCTGAGTTCCGGCACCAGTAGCAGGCCCGAAAGAGGCACCCTTCCATCTGATTC
CAGCACAACCTTCAAGCTGCTTTTTGTTTTTTGTTTTTTTGAGATGGAGTCTCGCTCTGT
TGCCCAGGCTGGAGTGCAGTGGCGAAATCCCTGCTCACTGCAGCCTCCGCTTCCCTGGTT
CAAGCGATTCTCTTGCCTCAGCTTCCCCAGTAGCTGGGACCACAGGTGCCCGCCACCACA
CCCAACTAATTTTTGTATTTTTAGTAGAGACAGGGTTTCACCATGTTGGCCAGGCTGCTC
TCAAACCCCTGACCTCAAATGATGTGCCTGCTTCAGCCTCCCACAGTGCTGGGATTACAG
GCATGGGCCACCACGCCTAGCCTCACGCTCCTTTCTGATCTTCACTAAGAACAAAAGAAG
CAGCAACTTGCAAGGGCGGCCTTTCCCACTGGTCCATCTGGTTTTCTCTCCAGGGGTCTT
GCAAAATTCCTGACGAGATAAGCAGTTATGTGACCTCACGTGCAAAGCCACCAACAGCCA
CTCAGAAAAGACGCACCAGCCCAGAAGTGCAGAACTGCAGTCACTGCACGTTTTCATCTC
TAGGGACCAGAACCAAACCCACCCTTTCTACTTCCAAGACTTATTTTCACATGTGGGGAG
GTTAATCTAGGAATGACTCGTTTAAGGCCTATTTTCATGATTTCTTTGTAGCATTTGGTG
CTTGACGTATTATTGTCCTTTGATTCCAAATAATATGTTTCCTTCCCTC
attgtctggcgtgtctgcgtggactggtgacgtgaatcaaaatcatccactgaattccag
gggctccattactgtcatctctcctgtgtgcgttgtggacttggcattcttctgtcggaa
caggttgctcagcagatcagcatcagctcgtgtcatacacagaactcaaaagtagagcaa