Gene TMPRSS3 Variant 1
DNA : 24.20 KbNT_030188
mRNA : 2437 bp NM_024022
CDS : 1365 bp NP_076927
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  150 bp
cttctgctatttccctgcttcctccgccctctcagagttacagggaatgacttagaaagg
tctctggtctccttggcattgtgataggtggaattctttcgtaggaaacacagccccggg
gttattttgatgcaagccgttggtccaaagccactccccactttgctatgtgggggaagg
ACCGGGCACCGGACGGCTCGGGTACTTTCGTTCTTAATTAGGTCATGCCCGTGTGAGCCA
GGAAAGGGCTGTGTTTATGGGAAGCCAGTAACACTGTGGCCTACTATCTCTTCCGTGGTG
CCATCTACATTTTTGGGACTCGGGAATTAT
gtgagtaccgaaactacttatgcttatggtaggtgtaccacacgcacagggaaagaattg
cgtttatgtgggacaggtgaaaacaatcgcaaaaaagcaatggaaagggctttgagagta
atttatcttctgaacaatagcaatatggcaacttctaaatggtgagagggagtccctcta
EXON 2  145 bp
gttatctgctgtagctcagacgaaaatgcattctcaccagatgactgtttttggttaatc
gatactgaatgcgctttgtgtggactgtcgaatttcaaagatttaccgtatgaccaagat
gcacctgatgctacaagtataaataggggaacaaatgctttctgttcttcctcggctaag
GAGGTAGAGGTGGAGGCGGAGCCGGATGTCAGAGGTCCTGAAATAGTCACCATGGGGGAA
AATGATCCGCCTGCTGTTGAAGCCCCCTTCTCATTCCGATCGCTTTTTGGCCTTGATGAT
TTGAAAATAAGTCCTGTTGCACCAG
gtaagtggacccaggtgaggactctgtgatttctgcccataccctcatgtaggtgaccaa
tgtgactgactgtccctgtgggggaaatatctccccagccattctgacacccacaggctg
gacacctgcacttccctagatctgcagaatctcagggagaaggggcattggagaggggat
EXON 3  111 bp
aggactgaactagagaatgtgccccttggtgggtggccctttccctaattaaggcacctt
tctttgggctgagacttctctgcaaagaggggagggggaaaggatagttaaatttgtaag
tttcatggcactccaagtcaggttctgtggctttctgctcttcctttttctggttttcag
ATGCAGATGCTGTTGCTGCACAGATCCTGTCACTGCTGCCATTGAAGTTTTTTCCAATCA
TCGTCATTGGGATCATTGCATTGATATTAGCACTGGCCATTGGTCTGGGCA
gtgagtacaattcattatttagtaggatctcaaatacctagccaagtagttaaactttca
tgagcgccccctctcatcccagcattttgctgctgcccagccttaattactggaggcaaa
catccttttggtttgctgacttgaagttttatttgcccacatgaatgtaaagtcagtctg
EXON 4  117 bp
accccttggaattcaaaacagaaactgggctgcaggaaacaggctgctgacagggacgca
atttcaatacaggtttcattattcacgggccagctccgcactgtgtggcagggggacagt
tgttagtgttgcactctgaaagagctgttggttaattcctgccttcctcccttttcccag
TCCACTTCGACTGCTCAGGGAAGTACAGATGTCGCTCATCCTTTAAGTGTATCGAGCTGA
TAGCTCGATGTGACGGAGTCTCGGATTGCAAAGACGGGGAGGACGAGTACCGCTGTG
gtaaggtcatggctcttcccctggggaaacagaaggaagcagcagaagccaaccctgacc
cttcccatctgtaaaatgggtccaagtcattgccatttttaggtcatgtcttcagctggg
attgaactggcgtttgcccaaagacatgttgggctggggggtcagggagggccttccatg
EXON 5  124 bp
agaccagcgagaagtctcagggatccagagtcactgctctgtgatggggaggctgccgtg
gacaagaagtgggtcagatttggcagaggaggggtttgagctggctgtggagaaacccct
gcctatggtctcagggttccactggccactaataagcctttctttctgcacatcggccag
TCCGGGTGGGTGGTCAGAATGCCGTGCTCCAGGTGTTCACAGCTGCTTCGTGGAAGACCA
TGTGCTCCGATGACTGGAAGGGTCACTACGCAAATGTTGCCTGTGCCCAACTGGGTTTCC
CAAG
gtaagttaaagagcatttccaacccatgggcaaaacacagagaggataacaataaagaaa
gacaactaccatttagttgggcactattgggtgctttaacgctctcagattacatcctca
catccaccttaggatgcccgatatcatcctcacttcacaggcaagcaaaccaaggccaga
EXON 6  126 bp
gaatgccttgccagggtgagtgaacttcattctcttggcaaaggaagcctttgatgggtt
tggggggacaaaatgacatcccccatgtacaatccctgtaatattgtgactcgcacatcg
gttgaatgcttcaaagtgtaaagttaccacgtcgggtctgtctttccaatgtgcttgcag
CTATGTGAGTTCAGATAACCTCAGAGTGAGCTCGCTGGAGGGGCAGTTCCGGGAGGAGTT
TGTGTCCATCGATCACCTCTTGCCAGATGACAAGGTGACTGCATTACACCACTCAGTATA
TGTGAG
gtaggtggtcaggcgatgctgttgtctgcacaggtatcgagtcacctgctggatttgtga
tgctatgcacaactccacaaggacttaagaggcatgcatgtgttatctcagatggaaggt
gggagttggccaccttgatgagactggtggatgcgccaggctgggggtgtgagaacctga
EXON 7  44 bp
attgtgtgacctcatcctcatggttttttttttttttgaacatagactaaaattgtaatc
tatattcaaagagggggaaatagaatttatttttctgttaccctaagattgagtttttaa
gagtgttcctttcacagatctggggcatttttcacagagcctactttttctccgctttag
GGAGGGATGTGCCTCTGGCCACGTGGTTACCTTGCAGTGCACAG
gtaagagttccagaaaggcaggggtccagggggagcaagcacatgctaagtcctatctcc
ttgccctcagagtcctctccccccatggggctctgtatcccttcctcctgggtgccaggc
gggaactctgtgtacccctacctgctggaggaggggagcagtgtcatcctcacctgtcgg
EXON 8  166 bp
caagagcctgaccacctcccctgctgagctcccccttgcagcacttgtcttagagctgct
gtgagctctgggagcaggggcagtgagggtggggagagaggagcaggtgcatggtggtga
caccatgtcccccaaagaagtctgcagggtggacccacaagcctttgttcccctccatag
CCTGTGGTCATAGAAGGGGCTACAGCTCACGCATCGTGGGTGGAAACATGTCCTTGCTCT
CGCAGTGGCCCTGGCAGGCCAGCCTTCAGTTCCAGGGCTACCACCTGTGCGGGGGCTCTG
TCATCACGCCCCTGTGGATCATCACTGCTGCACACTGTGTTTATGA
gtgagtgctgctgaccatcttcccagacccctgttcactcctgggtcatgtcagggtggg
gctgctttgggtggtgagaagcgggtccagagggaagacagagagactaacctccaagta
atgtacagttggagaggagtctccagcctcactgtggacccatcatcatcagctgggggt
EXON 9  170 bp
tgtgtttctgtagggcgtggcagtgcagttgcatatacagcataaacaagcagggtgatg
ggaccacatcttgcctgataacctctcccaccatcttcctaggttttcaggatacctgag
gtcaatgagttcagtggttggacttttcctgtgcttcacctcttgctcttctcatttcag
CTTGTACCTCCCCAAGTCATGGACCATCCAGGTGGGTCTAGTTTCCCTGTTGGACAATCC
AGCCCCATCCCACTTGGTGGAGAAGATTGTCTACCACAGCAAGTACAAGCCAAAGAGGCT
GGGCAATGACATCGCCCTTATGAAGCTGGCCGGGCCACTCACGTTCAATG
gtacatctgggtctctatgtggttctgcagctcttcctttgtttcaagaggatttgcaat
tgctcattgaagcattcttatgatggctgctttataatccttgtcagatattaataattc
caactcctgattcatgttggtgttggcatcagttgattatcttttctcattaaaattgtg
EXON 10  96 bp
ggtgtggtggatggggtaaggggctcctgctgtgagctgatcgttttcaagtaaccaagg
gcttgaccttccttcccttgggagatagtttgggctcctcagaggcagaagcatagatga
gattgttttctcggactcctgcttcaattgagttgtgaactattgtttcccttcaagcag
AAATGATCCAGCCTGTGTGCCTGCCCAACTCTGAAGAGAACTTCCCCGATGGAAAAGTGT
GCTGGACGTCAGGATGGGGGGCCACAGAGGATGGAG
gtcagtgggctgaagccaagattcggagtccaggggctcagaacccagagggctgcggag
ggggctcccccaatgtcccattgtgatgttcccatgggctgcccagataccccggccagg
gagtgcatgtcagctgctcgggacacagtcagccaaggaactgtgggtcaggagtcacgg
EXON 11  146 bp
cttcgagacagtgggagtctgctcgtcccacccgcagggccctgtccttttccgctgttg
cgacacaccagagagcatccccctcgtccctcgttccctcacccccctggtctcagcatg
cgccttctgtgttttgggccgggcttccttctcacacacatcccctcactcactttgaag
CAGGTGACGCCTCCCCTGTCCTGAACCACGCGGCCGTCCCTTTGATTTCCAACAAGATCT
GCAACCACAGGGACGTGTACGGTGGCATCATCTCCCCCTCCATGCTCTGCGCGGGCTACC
TGACGGGTGGCGTGGACAGCTGCCAG
gtacggggccgcagcggtgggcgaggccgtggcagggtgacccagcccttgggacaggtc
gttgccagcgtttccctgtgacaggacaaaaagtaaatttacagggcgtggagaagaaat
ttgctcaagatatcactccttttcctggctgccagccctgtgtttacccagtgatctggc
EXON 12  153 bp
gggatgctgtgtctggaagggctggtgggttcccttctgtaacctgggtcatccattggg
acatcatgaaggggggtcccaactccatagcaagcagcctcacacggcagactgtccaca
gaaagcaatctcgcatggcggtgactgtcccccaatctttgcttctttcctgtcacccag
GGGGACAGCGGGGGGCCCCTGGTGTGTCAAGAGAGGAGGCTGTGGAAGTTAGTGGGAGCG
ACCAGCTTTGGCATCGGCTGCGCAGAGGTGAACAAGCCTGGGGTGTACACCCGTGTCACC
TCCTTCCTGGACTGGATCCACGAGCAGATGGAG
gtgggtgcggcgccctccccagctcacgttgtccctggcttttgaccctaaggtccctta
aatgcaaccctggtcttgctataaaaaccagggcgtgacccagtggttgtcaattcagca
gcagtgacttggtggctccagggtgtcagacgcttgtgctgaaaacagagatcacagcta
EXON 13  889 bp
ttcatgcctgcctgggatccactcagagctggcagccccagggggaggccaaccttgtct
tcatcgtggagaacagccccacaattcccacagggcaaaatgcaggtgcccgctccgtca
tcatgttggacggatggctggaagtgctaaaaacaataacgcctttgttttcatttatag
AGAGACCTAAAAACCTGAAGAGGAAGGGGACAAGTAGCCACCTGAGTTCCTGAGGTGATG
AAGACAGCCCGATCCTCCCCTGGACTCCCGTGTAGGAACCTGCACACGAGCAGACACCCT
TGGAGCTCTGAGTTCCGGCACCAGTAGCAGGCCCGAAAGAGGCACCCTTCCATCTGATTC
CAGCACAACCTTCAAGCTGCTTTTTGTTTTTTGTTTTTTTGAGATGGAGTCTCGCTCTGT
TGCCCAGGCTGGAGTGCAGTGGCGAAATCCCTGCTCACTGCAGCCTCCGCTTCCCTGGTT
CAAGCGATTCTCTTGCCTCAGCTTCCCCAGTAGCTGGGACCACAGGTGCCCGCCACCACA
CCCAACTAATTTTTGTATTTTTAGTAGAGACAGGGTTTCACCATGTTGGCCAGGCTGCTC
TCAAACCCCTGACCTCAAATGATGTGCCTGCTTCAGCCTCCCACAGTGCTGGGATTACAG
GCATGGGCCACCACGCCTAGCCTCACGCTCCTTTCTGATCTTCACTAAGAACAAAAGAAG
CAGCAACTTGCAAGGGCGGCCTTTCCCACTGGTCCATCTGGTTTTCTCTCCAGGGGTCTT
GCAAAATTCCTGACGAGATAAGCAGTTATGTGACCTCACGTGCAAAGCCACCAACAGCCA
CTCAGAAAAGACGCACCAGCCCAGAAGTGCAGAACTGCAGTCACTGCACGTTTTCATCTC
TAGGGACCAGAACCAAACCCACCCTTTCTACTTCCAAGACTTATTTTCACATGTGGGGAG
GTTAATCTAGGAATGACTCGTTTAAGGCCTATTTTCATGATTTCTTTGTAGCATTTGGTG
CTTGACGTATTATTGTCCTTTGATTCCAAATAATATGTTTCCTTCCCTC
attgtctggcgtgtctgcgtggactggtgacgtgaatcaaaatcatccactgaattccag
gggctccattactgtcatctctcctgtgtgcgttgtggacttggcattcttctgtcggaa
caggttgctcagcagatcagcatcagctcgtgtcatacacagaactcaaaagtagagcaa