Gene TCP10L Variant 1
DNA : 8.95 KbNT_011512
mRNA : 957 bp NM_144659
CDS : 648 bp NP_653260
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  86 bp
ctctccaatgtcctttgtggatggatggactccactgacgatgagcttctatattaagaa
ttgcaggtttggggatgtttaattattatctgagctggtacagtggtgacgctgagtgag
acgttcatgtccctttaagacagaaagtccgttggaactgtccgctgctctctggtctct
GGATATGAGGCAGGAGGGCTTGGGGACAACTGTGGGGACATGGCCCAGATGATCTGATCC
TGGCAGTAGTGACTGTTGGGGACCAG
gtgaggtgacgaggtctggtggtggggctgaaggaaagggtcttccctggactgaggggg
tcatgagtttggggccgaggacactggggtgtcccctcagaggagcaggaaagaaggagc
tttctcagggctgtgaggaccgtgaccccagcccacttccgcagaaacattcccagtctc
EXON 2  145 bp
gtctgtggtgtcctttcacctggtcagcttcgggcctgggaatgtgcacatgacccaggg
ggagaaggagcggctgcgggtcctgctcacccttagtttggggctggggccttcagccca
cactgacggggtaggagggctgcattcaagtgtccccatagcccttcccttcccaaccag
GATGCTGGCAGGTCAACTCGAGGCCAGGGACCCCAAAGAGGGCACCCACCCAGAGGACCC
GTGCCCAGGAGCTGGGGCTGTCATGGAGAAGACAGCTGTGGCAGCCGAGGTTCTCACGGA
GGACTGCAACACTGGGGAGATGCCA
gtgagttgagctctgtggggacagagttagtcccaccaggcgggaccctgattcctgtcc
ctgaggcccgtcattggactttcccttgctggacccctgtaggaatgcaccaccccggga
cactgattctgtacttcctctccaaggggcatgtggctctttccccctctgcaaccgtat
EXON 3  216 bp
agaaagaaaggaaagaaagaagaaagaaaaaggctgtggtagtcctgtttatctcatcgg
gtgtcttttattccagaaatagtgttggtcttacatcagagagggcttgagtattttgca
gataaatgtgcccattgtgacatctgagaggtttttctggtgttctcttcccaataacag
CCATTACAGCAGCAGATCATCAGACTCCACCAAGAGCTTGGGAGACAGAAGTCTCTGTGG
GCTGATGTTCATGGAAAACTCCGGAGTCATATAGATGCTTTGAGGGAGCAGAACATGGAG
CTCCGAGAAAAGCTGAGAGCTCTGCAGCTGCAGCGGTGGAAAGCCAGGAAGAAATCTGCA
GCGTCCCCACACGCGGGGCAAGAATCGCACACTCTG
gtaccaaaagcgcatttatgtttttgtaccgtttgcgttatgtaaaaatagcgtccccat
aaagatgtgggctttattgctgaatgacgcggtatcactcacgctccgggtggtgggagg
ggttgctatctttccatcaactccatttcccgtaagtaatgattaataagaactggatac
EXON 4  138 bp
acaaacgcttggtgagggtttctgttcttatcaacatattagggggaaaacccagtccaa
gtccccctaccttgtaccctatttttttctaggacattccaattattcttcattgtatta
aaatttgaatttattttaccttcgaaaatgtgaagaatttccctgcattttgtcttttag
GCATTGGAACCTGCTTTTGGAAAAATTTCACCTCTGTCAGCTGATGAAGAGACAATACCC
AAATACGCTGGCCACAAGAATCAGAGTGCCACTCTCCTGGGACAAAGATCGTCATCTAAC
AATTCAGCTCCTCCAAAG
gtgaccctttgtgcttatcatctgtaaagagaagcagaggttctgtacccaaacacacac
atcccatcagctcctcaccacacaatttcacctccctgggtgagcatggtgctccctgga
gtcctgtgttcttccaaggacacgggtacatgcctttcaaacaagatcctaacccttagc
EXON 5  372 bp
agagcgtgggctgtaaaatggggaatgagagacactaagtgtggatacctcatgtgtcct
tctgtaggaagggggagtagaatcatctacattctgtgatagctggtatgatgtgttgct
taacatttaaaaataatataattgttactaatgcaaaaatattcccacatttgttttcag
CCAATGAGTTTAAAGATAGAAAGAATTAGCTCGTGGAAAACACCACCACAGGAAAATAGA
GATAAAAATCTTTCCAGGAGACGTCAAGACAGAAGAGCAACACCTACTGGAAGGCCAACT
CCCTGTGCAGAGAGACGGGGGGGTGTCTGAAGATGGAAAGGTGGCCTCGGACACCTGTGT
CACTCTACACTGGCCCCTTGGAAAATTCAGATTCAGATAAAGTTCCACTTAGGTCTAATA
AAAGTACTCAATTTGTTATTCAAAATAGACCTAGTAATTTATTAAACTAATTATGTTTCT
ATAGATAAAAACTTGAAGTTCTTCAGACATGTCTCTAATGCTATAAAAGCAAACAACTTG
GATTGGGTTTTA
taaatcagttgctttcctgagctctgtagttggtatatttctgcagagtctttaaaaaaa
ttaacccaccttgtagtatggagtgtcgggctgttgggtgagccctggggtcttgctgga
aatcgaggatggctgaagatggctttgtgctcccagcctttgggctcaaggcattgcccg