Gene SOD1 Variant 1
DNA : 8.97 KbNT_011512
mRNA : 627 bp NM_000454
CDS : 465 bp NP_000445
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  139 bp
ccggcgcacgcggccccttggccccgcccccagtcattcccggccactcgcgacccgagg
ctgccgcagggggcgggctgagcgcgtgcgaggcgattggtttggggccagagtgggcga
ggcgcggaggtctggcctataaagtagtcgcggagacggggtgctggtttgcgtcgtagt
CTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTCGGCGTGGCCTA
GCGAGTTATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCAT
CATCAATTTCGAGCAGAAG
gcaagggctgggacggaggcttgtttgcgaggccgctcccacccgctcgtccccccgcgc
acctttgctaggagcgggtcgcccgccaggcctcggggccgccctggtccagcgcccggt
cccggcccgtgccgcccggtcggtgccttcgcccccagcggtgcggtgcccaagtgctga
EXON 2  97 bp
cctagagcagttaagcagcttgctggaggttcactggctagaaagtggtcagcctgggat
ttggacacagatttttccactcccaagtctggctgctttttacttcactgtgaggggtaa
aggtaaatcagctgttttctttgttcagaaactctctccaactttgcacttttcttaaag
GAAAGTAATGGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACTGAAGGCCTGCAT
GGATTCCATGTTCATGAGTTTGGAGATAATACAGCAG
gtgggtgttgtgctgtgctggtgacccatacttgttcaccctagttagataaacagtaga
gtagcccctaaacgttaaaacccctcaacttgtttttgtttttgagaaagggtcttgctc
tgtcgctcaggctggagtgcagtggcgctgtgcgatcatggctgaccttagccttgacct
EXON 3  70 bp
tggccatagacttgtttctgttcccttctcactgtggctgtaccaaggtgttgcttatcc
cagaagtcgtgatgcaggtcagcactttctccatgggaagttttagcagtgtttcttttt
agaatgtatttgggaactttaattcataatttagcttttttttcttcttcttataaatag
GCTGTACCAGTGCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGG
ATGAAGAGAG
gtaacaagatgcttaactcttgtaataatggcgatagctttctggagttcatatggtata
ctacttgtaaatatgtgctaagataattccgtgtttcccccacctttgcttttgaacttg
ctgactcatctaaacccctgctcccaaatgctggaatgcttttacttcctgggcttaaag
EXON 4  118 bp
tctttcttcccagagcattagtgtgtagacgtgaagccttgtttgaagagctgtatttag
aatgcctagctacttgtttgcaaatttgtgtctactcagtcaagttttaatttagctcat
gaactaccttgatgtttagtggcatcagccctaatccatctgatgctttttcattattag
GCATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTAT
TGAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTG
gtaagttttcataaaaggatatgcataaaacttcttctaacatacagtcatgtatctttt
cactttgattgttagtcgcggtttctaaagatccagataaactgtacttgcagttcaaat
taggaaaagcaattttattggacaattacggtgaaaatgaattattttatctaggtcagt
EXON 5  203 bp
caagaaaaagctttgagtagtagtttctacttttaaactactaaatattagtatatctct
ctactaggattaatgttatttttctaatattatgaggttcttaaacatcttttgggtatt
gttgggaggaggtagtgattacttgacagcccaaagttatcttcttaaaattttttacag
GTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGA
AACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAAACATTCCCTTGG
ATGTAGTCTGAGGCCCCTTAACTCATCTGTTATCCTGCTAGCTGTAGAAATGTATCCTGA
TAAACATTAAACACTGTAATCTT
aaaagtgtaattgtgtgactttttcagagttgctttaaagtacctgtagtgagaaactga
tttatgatcacttggaagatttgtatagttttataaaactcagttaaaatgtctgtttca
atgacctgtattttgccagacttaaatcacagatgggtattaaacttgtcagaatttctt