Gene SH3BGR Variant 1
DNA : 63.61 KbNT_011512
mRNA : 1187 bp NM_007341
CDS : 720 bp NP_031367
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  248 bp
cccacctcccttggccccaaggcatctctgcacaggtctccgattggtgcacagcacagc
ctggccttttagggactgttgtcgcgcgtttaaagtgatagggaaagggtccagtggctg
cttttatcgaccaatcaaatattttcctgacagatcccaaaatattcctgggccaatgga
GGGAGGAGCCCAAGATGCCTCTGCTGCTCCTTGGAGAGACAGAGCCTCTTAAGTTGGAGC
GGGACTGCCGGAGCCCAGTGGACCCCTGGGCTGCTGCCAGCCCCGACCTGGCACTTGCTT
GCCTGTGTCACTGTCAGGATTTGTCTAGCGGCGCATTCCCTGACAGGGGTGTGTTGGGGG
GAGTCCTCTTTCCAACTGTCGAAATGGTTATCAAAGTGTTTGTTGCTACATCTTCTGGGT
CCATAGCG
gtaggtgtctggtggactctttcttcctatactcttttctgaataacttagggttggaaa
tatggccaacgttggccttcagtttcttttttgcgtgtagtcagctgtggctctgcaata
agtatgtgcgccctttgctttctgcatttgatttcatagtgttgaaaaagcatggaaagg
EXON 2  186 bp
ttaaatagtcatttggttgaccctttataacaaagaggtgtgattctattattttccttg
tttgaatacttaacaaaattatttgtgttgtatagtataactagaggaaggatttaattt
ttgtaaatgtaagcaaaatatttttcataaacagcctaatatttctctactcttgaccag
ATTAGGAAGAAACAGCAAGAAGTAGTGGGTTTTTTGGAAGCGAATAAAATCGACTTTAAG
GAATTAGATATTGCTGGAGATGAAGACAACAGGAGGTGGATGAGAGAGAATGTTCCTGGA
GAGAAAAAACCTCAAAATGGGATTCCTTTGCCTCCCCAGATCTTCAATGAGGAGCAGTAC
TGTGGG
gtgagtatgtgcttctattaaaaatcctgctgtgtgtgtgtttattagaaattttctaaa
gcagattaagtttgagtcagcatttgaaattattcacaactgtcaggtcatggtctattt
ctgccatccaatagctggatggtagatccattatgaataatcaatatttaagatttagaa
EXON 3  81 bp
taaagttcatggttagatttcttaactctggaggttagtcatctttgataaagcaaactg
ggatgactttttgtgtgagctcctaacttaaggactaagaaatacaaaagatcagtttcc
gtaaataaactggctcacaagtgtgcagtagttttaaactttctttttctttgcttcaag
GATTTTGACTCTTTCTTCTCTGCAAAAGAAGAGAATATTATTTATTCCTTCCTTGGTTTG
GCTCCTCCTCCAGACTCAAAG
gtaagtttgaacaaactccattggggttcaaaacaggtaatactaaatgaaggtagaaat
caccgcatccaagactgtttaatacatgatgatctctaaattaacattactttagtacac
ttcttattctgatgcagtcctatgcatagagagaatgcagtttttactaaaaaaagttcc
EXON 4  93 bp
gcattttggagtttggagatcctatgctctagtcgctaagtgacctaatgagtgggcagt
ctatgtttgcttcatttatatactgtgtgtctaaataagaaagccacagcatatgtggcc
tgtttttttttttcttttttctgtttttgagctcatatcctgggtttcctttatgaccag
GGATCAGAGAAGGCTGAAGAAGGTGGAGAAACTGAGGCACAAAAAGAGGGCAGTGAAGAT
GTGGGCAACCTCCCTGAAGCCCAGGAGAAGAAT
gtgagttttcgctttttcacagcagtttgactggattctctgctgttcgagacttttaca
gggcttgtacaacttgactctgggcacaagcagtcagaaagagggcaaggagctgagagt
ttagccagggaggaagcaagtaatttctactgatgtgttaagcactggaatcctggtgca
EXON 5  30 bp
tgaaagaagtagggatcacccagctatcatatctttgctatttacttattttatggataa
actaatgtgttgttcattttgattagcttgtattttattatagtttgcttgattttcaga
tttgactttaaacgtacttgaattatgtttttttctttaattttgatttatggatgtaag
GAAGAAGAAGGAGAGACAGCCACAGAAGAG
gtacggtcgaccatctttaacagctgtgcttaatctgcttaataaaaacatcttttaggt
gggaggattgcagcttgaggcacgttcttaataacataagagagcgatgcaacccacaca
cccagaaaatcctcctttaacatgctgagaaggaaagtaagttggagataagtttgtccg
EXON 6  130 bp
tggcatgtgtttgtgtggcatgtgtggtgtgtgtatttgtgtgttgtgtgtgtttgtttg
tgtgttgtgtggtggggtgtgggaggctttgacctctagtccagcattttacagtctttt
tctcactgtatccttggcccttatgcttcttaatactaatgtaagttttgttaaaataag
ACGGAAGAAATAGCCATGGAGGGTGCGGAAGGGGAAGCCGAGGAGGAGGAAGAAACTGCA
GAAGGAGAAGAGCCTGGAGAAGACGAAGATTCCTAGGCCTTTTCATGCTTCATTTCTTCC
ACTTCTCCAG
gtagctacaggattctggggtggaaaagctgctagttaccgtactgtatgctatctgcgg
cacattttgcttagtaacaggagaaagggaattccaattcagggctgtctgtctccttcc
aaagccctggtctgcacacctttctggcggggtccagctcctttctagagctgcggggct
EXON 7  419 bp
tctagcttagttttccatgagacaaattccctttcctttcagtggggagcaaatgatgac
tagtggtttatagaataaaaggcaacactttcctttattgtatgttaagtgatgaagatt
gtggtaaacattctgtgtctttctctacagtctttccctaatatttgccttttcttttag
AAAATGGAAGCTATGAAGCAACATTTCAAATGTCTCTCCACAAACCAAACTCAACAGAAT
ACTTTGGCTTGAAGCCGGCACACCCAGGGTTACTGAGGACTTATGCTGCCTGACCTGGTT
AGATGTACATGGAGGTATCTCCCGAATCATACAAAATTAAATGTGAAGACCGTTTATGCA
TACCTTCATGTGCCTGACAGTCTTGGCTTTTGAAGATTTTTTTTTCTTTTTTGCTCTGCA
TAGCTAGACCATCTTATTAATAATACTCTGAAAAAAATGATTTCAAGGCATGGAAGTTCT
CTGTGATACAACAATAGTATTTCTTCAAATGCGCCTTATGCTACTTATCTCAGAAACAGG
TTTTAAAATGAAGTGCTTTCCAGAGAACCATCATATAAATAAAGATTAATAGAAAAATA
tcttgtcccaaggagcatcatttcattatttatagtctctgcttgcatatgcctgaactc
cgtctgtctgttgccaagtctaaatcttcagcagcacttttctgtctgcgttgggatcga
tgtcttttattgcactgattatttggtccatgttttcaattgcattgattgtctcattac