Gene PRDM15 Variant 1
DNA : 16.39 KbNT_030187
mRNA : 2606 bp NM_144771
CDS : 1062 bp NP_658984
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  85 bp
cctcgggggccggcccacaccctcaccagtaccgcacgggccgctgcctgtgcctgcccc
agggtctcgggcacgggcccccaggtgggctgcgtgggggtgtggccgcctctgactcgc
tgtgtccttgaaggcatgaagaccaagcacgcgctgcgccaccacatgaagctgcacaag
GGCATCAAGGAGTACGAGTGCAAGGAGTGCCACCGCAGGTTCGCGCAGAAGGTCAACATG
CTCAAGCACTGCAAGCGGCACACGG
gtgagtccgaggcccgggccgcgccagccacggcgctcactgtgtagggaagccaggtgg
gccgtgggagaagagagagccgccttgagacgattcctctttgtgattcccactgagtgc
cgggttccccaagagagcttcctggggccggggtgagcagctgcatatctcaaaaggtcc
EXON 2  84 bp
tccaagccacactttgctggccgaggctggagatgagcgttcattgtctgctgtcttctt
gcaattcaccttctccagaaggccctacagtgcctggaacgtgtcagggagaagacatgc
cctgatgtggacttacaacactcattaaacgtaggaagttatgtgcgcctttctctgcag
GGATTAAAGATTTCATGTGTGAATTGTGTGGGAAGACATTCAGCGAGAGGAACACCATGG
AGACCCACAAGCTCATCCACACAG
gtgagcggcgcagcctgaaggagccttcggggcgcacgcggcaggctgccggggctgtct
gagtgcctgctggggtggaaacgactattctattatctagacggttccagcacatttagt
gttgtcttggcttcatggtggccccttggcctctgaaggtcaacccgccacagctttcaa
EXON 3  176 bp
aagggacagaggctctgtgctcatgtgtgctcggggaccagcaccggccctctcaggatg
ggcggggcgtgacaggcttcttgcctcgtccagcaggccagggtcattgggatggctgca
ctagtgacctgcgtgtctcttcctttccacgcgcatgtgtgtctgcgtgtgtgtgaaaag
TGGGCAAGCAGTGGACGTGCTCCGTGTGCGACAAGAAGTACGTGACCGAGTACATGCTGC
AGAAGCACGTTCAGCTCACACACGACAAGGTGGAGGCGCAGAGCTGCCAGCTGTGCGGGA
CCAAGGTGTCCACCAGGGCCTCCATGAGCCGACACATGCGGCGCAAGCACCCCGAG
gtgagctggtggctgtgccccctccgtgccccgccagcgggccgcgcaccggacaccccc
atgctggcacatggcccacctccctctgcagacccccagtactggaggcaggccctgagt
cttaggtgcgtctgtgactggcactgcctgccacacaggaggcactgagtgagtggctgc
EXON 4  81 bp
gggcttctggacacagagtttcaaagtcagagctgaacagaggagactgggaagtgcggg
ggatgcctgggagggaagggcaggagtggtggaggtggtcccaaggcgtgtgtggcttct
gggttcccacctgcatcagcagcaccctgacccccagctcatgccctgtgctcctcatag
GTGCTCGCGGTGAGGATCGATGACCTGGACCACCTCCCGGAGACCACCACCATCGACGCC
TCCTCCATTGGCATCGTCCAG
gtgagcagcatggggccccaggggctcagaaactttggggtaagtggacacctgcagaag
ggaccagaggggcttggacaggccgggagggagcagctctgggcaagcctgtggccaggt
taccctgttttcttggcttctcttcccctcagaacctcttagatcatctcctcgtttctg
EXON 5  210 bp
ttgccccgatccttagaaatacaagacccagctgtggtcactgtttcttgtggcagctcg
gtggcccacaagcgtccccactgattggagagtgtgtccagggcagtgctggggctgccc
tggccgctgcctgacgtgaccgactaacctggttctcggctgaaaccgatttttctgcag
CCTGAGCTGACTCTGGAGCAGGAGGATTTGGCCGAAGGGAAGCACGGGAAAGCTGCCAAG
CGAAGTCACAAGAGAAAGCAGAAGCCAGAAGAGGAGGCGGGTGCTCCGGTGCCCGAGGAC
GCCACCTTCAGCGAATACTCAGAGAAAGAGACGGAGTTCACAGGCAGTGTAGGCGACGAG
ACCAATTCCGCAGTACAGAGCATTCAGCAG
gtcagtttgctgctttatgttctgattaggtgccggtcactttccctaagcatgagagcc
ttacgtgtgtgtgactccatctctttttactatacacagtgtacatgtggacttcatgtg
gttgaaggcagcagacattctgtttttcacttaagcatgtttcatgtaagcatttctgag
EXON 6  1539 bp
tctgtttcttgtttttgtttctcgctggaatttttccagaacaaaattaactcggtttcc
tctttcaccaaagaatgtcgtgcttctttggtgtggtaacacagagcgcatcctggggag
gtccttgcgttccccattttgcaaaaatgaacggatttttgttgtgtgtgaatcttccag
GTAGTGGTGACCCTGGGTGACCCAAATGTGACCACACCATCGAGCTCAGTCGGCTTAACC
AACATCACCGTGACCCCCATCACCACTGCGGCCGCGACTCAGTTTACCAATCTCCAGCCG
GTGGCCGTGGGGCACCTTACCACCCCTGAACGCCAGTTACAGCTGGACAACTCAATCCTG
ACCGTGACCTTTGATACCGTCAGCGGCTCTGCCATGTTGCACAACCGCCAAAATGACGTC
CAGATCCACCCCCAGCCGGAAGCCTCGAACCCACAGTCTGTGGCCCATTTCATCAACCTG
ACGACCCTGGTCAACTCCATCACGCCCCTGGGGAGCCAGCTTAGTGACCAGCACCCGCTC
ACGTGGCGGGCAGTGCCCCAGACTGACGTCTTGCCACCCTCGCAGCCGCAGGCACCCCCA
CAGCAGGCGGCCCAGCCCCAGGTGCAGGCGGAGCAGCAGCAGCAGCAGATGTACAGCTAC
TGAGCTGCGTTCCGGGAGACTCGGGGCAAGAACTGCAGAGGGATGTTTGGGATTTGTTTA
GATGTGTTTGCTGGATACCAAACAAACAAAAAGTCATACATTGCAATGTAAGGTTGACTT
AGCTTTGCAGAGTATCTCCAGATCCCCCGCCAGCAACCATTACGGTCTGTCAGCTTAACT
CTAGAAGGGACCTCTGGCAGGCCAGAGTTTTAAACTGGATGGGGCTCCACACCATGCCTT
ACCAAGGCAGTAAGTCCTGGGCCGGGGCCGCATCTGCCTCCCCTTACAGAACCAGTGTTC
GCCCGACACAGGGTTCGGGAAAGTGAAGCTGAGAGAGAAGCAGGATTTTAAGAGGCAGGA
GATAAGTTATTAGGAACACAAATGGTTCATTTTCTTTTTTCTTTTAGAGCTCGGTTCCTA
TGAGAACACAGACAGTATTCACAGGTGGCAGCAGGCAGCAGGGAACATTTTCTCCTCACT
TCTGGATTTTTTTGCAAGCGAGCACATAGAAGTTAAAGTAACGTGTATTCTCTTTGAACT
AGGAGTGGAGTCGGTTCTTATACAACTATGGGCTGAAACCATGAGGCGTGCTGAGCCGCA
CCTGATCCTGCAACCTTCGAGGTCATCACGGTCATCATGTGCAAGGGGTCACGTGAGGTC
ACTGACTCCAGCTCAAAACGCATCTTAGTAATATCCATGAATCGATTTCCAATAGAGTTT
TTTTCCTTTTTTTTTTTTAACTTTATTTCAAACATACATTATGTGTTCAAGACTGTTATG
GCCAATATTGTGTTTTAGTTTTATGTTAACATGATAAAGTCATGTGCACTGTAGGACCAT
CTGTCCCTGTCCACCCTTCACAGCTGCCCAGATGCAGAGGGTCGCGCGGCTGTGTGTGAG
GAGTGAGCCTCCCTGCTGCCCCCAGGGGCTCCTCCGGGTTGTCTCAGGATTCTCTGCAAT
CCAAATGTATCCATTCTGGCTGAAGCCCAGCCAGAATCCCGAGTGGAAGAAACGGGGGAA
AAGTCATATTTTCCTTCTGTTTAAACTTCAATTCCAAAG
gttggtgtatttcatgaccagttttctataaaaatattgaatgagtttggctctttacaa
tggaaaagtgtaggtatttctgaaacacagagaaaatgctatttcctgccaggtggtaat
gaaagcagagaggttagttcactaatagaagcattaattgcccctaaaactgaatgtgcg
EXON 7  161 bp
gggtcactgtctgaggcaaaatgggttgtcttaaagcaattgctacaaatttgcatcaaa
gaaactagatagcaaaatacaacaaccatgtaccacccaggcagaagagtcctcacctat
acgcagttctgcatattgatcatcatgacaggaagtatttcgttttttaactgatcccag
GTGCACAGATGTATTCATAAAGGAAGACATTAGATCCAGCCATTGTGGCCACCAGGCTCT
GTGGACCCATCTCAGTGGAGAATTCGTTTTGGACCCGTGGCTCCGTGCAGCTGTGGACTC
GAGTGCCATCCACTGGTGTGAGTCTTGCGGGGAGGCCACAG
gtacagctgctccccgtgaatcctggtctgtgggttgagaaggggctcgggcctctggaa
tgctctagcgtgtgacgtgttctcaggaaaacgttctgtgccaagtgccgcctcgctgtg
tccggcatgggactgcgctggagggtccggcgtggaaggcagacctcctgtacctctatc
EXON 8  270 bp
catctcagtggagaattcgttttggacccgtggctccgtgcagctgtggactcgagtgcc
atccactggtgtgagtcttgcggggaggccacaggtacagctgctccccgtgaatcctgg
tctgtgggttgagaaggggctcgggcctctggaatgctctagcgtgtgacgtgttctcag
GAAAACGTTCTGTGCCAAGTGCCGCCTCGCTGTGTCCGGCATGGGACTGCGCTGGAGGGT
CCGGCGTGGAAGGCAGACCTCCTGTACCTCTATCGTTCCCATTTGTGGCATCCAAAGGCG
GAAGGCTCATGGCTTCCCCACTAGAGGCGGCGTCTTGGGCTTTCCCATTGGATTGTGAAA
GGCATTAAGACTGTTTGGAGATGTTGGCTGTATTTCCTGTCACATCAGGTTGTATGATGA
CGAATAAAAGGTGCTGTGACCCGTGTTTTC
aattgctggccttctgctcccgctgcctgttagggaaggtggtgcagttcatatactttg
agaacgctcacgattcctgccgtcagccacatcttgattcctctcaggtccagaactcat
aaaatgtttggattatttgaaatgttccctgagatattgaggtatcagaagctttcacag