Gene CSTB Variant 1
DNA : 2.43 KbNT_011515
mRNA : 657 bp NM_000100
CDS : 297 bp NP_000091
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  175 bp
agccccgggaggggggcgctccctcccgacaccagcgctgggcgcggagacccagcctgc
ggcgagtggtggccaggttccccgccccgcgccccgccccgcgccccgccccgcgcgtcc
cttcttgcggggccaccgcgaccccgcaggggactccgaagccaaagtgcctcctccccg
CCCCTTGGTTCCGCCCGCGCGTCACGTGACCCCAGCGCCTACTTGGGCTGAGGAGCCGCC
GCGTCCCCTCGCCGAGTCCCCTCGCCAGATTCCCTCCGTCGCCGCCAAGATGATGTGCGG
GGCGCCCTCCGCCACGCAGCCGGCCACCGCCGAGACCCAGCACATCGCCGACCAG
gtgggtgggccgcggggacggggccggcccggagtcctgccttagcctcagggcgcggcc
gcggctcctggagcgaaagaagccgctttggccccgctgcgcacccctgggctggcccgg
gctgtggccgtgagaggcctccctccgctcgggcgctgcgcgcgagtgagcagcgggggg
EXON 2  102 bp
aactgtttttttctactttattattaggctgacagtttaaatgtcccttcagttgtaaga
gacaattgtgtgaagagccagtgtcagaatcgtgtgtgtgctcacatgcgtgcaagttac
tctagcaggagggaatccaagaagccactgagacatcctcattctgtcccttctgtctag
GTGAGGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCA
TTCAAGAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAG
gtagagtgtgggcctcaggagggcctgccccgaacgggtgctggtaggaaaccgcctgtg
caggcccgggctgtgtggtcttaggtgctggggcgccctgtggctgccccctgagataag
catcctactgtgtgtgtccatcggcctttcaggaggactagggcttctggggagctaaga
EXON 3  380 bp
ttcaggaggactagggcttctggggagctaagaaccccaaggaaacaagtgtgggatgtg
aggcatcccctgcacatgcaggagaagacaagattgtcttcagctggctgctaatgacct
ggaggggcgcagcaaggtgacttgggatcagaggcttcgctcactccgctctcttcccag
GTGCACGTCGGCGACGAGGACTTCGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAA
AACAAGCCCTTGACCTTATCTAACTACCAGACCAACAAAGCCAAGCATGATGAGCTGACC
TATTTCTGATCCTGACTTTGGACAAGGCCCTTCAGCCAGAAGACTGACAAAGTCATCCTC
CGTCTACCAGAGCGTGCACTTGTGATCCTAAAATAAGCTTCATCTCCGGGCTGTGCCCCT
TGGGGTGGAAGGGGCAGGATTCTGCAGCTGCTTTTGCATTTCTCTTCCTAAATTTCATTG
TGTTGATTTCTTTCCTTCCCAATAGGTGATCTTAATTACTTTCAGAATATTTTCAAAATA
GATATATTTTTAAAATCCTT
acagattgcctcctttgttttagacttttttcttcgtctgaaccaccccgggcaggtcct
tcccctcgggggcatggagggcggagagactgcctggctcacacagcaagcaggtggtgg
acccaggattcacacctgcccactccggcccgcgttcctaaccaccactctttacatgtt