Gene ABCG1 Variant 1
DNA : 77.97 KbNT_030188
mRNA : 2881 bp NM_004915
CDS : 2025 bp NP_004906
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  36 bp
tcggggcggggtcgggcgcgctggaaccagagccggagccggatcccagccggagcccaa
gcgcagcccgcaccccgcgcagcggctgagccgggagccagcgcagcctcggccccgcag
ctcaagcctcgtccccgccgccgccgccgccgccgccgccgccgcccccggggcatggcc
TGTCTGATGGCCGCTTTCTCGGTCGGCACCGCCATG
gtgagtgagcgcatccttcgtccgccgggaacggttttattttcaaggagagcaggaaac
acacaaagactcgcaagctcgacctgacacccctcccaggagcgcgtcctctgggcgctg
acccagggcaccctagagtggcgcccggctccgatcgctgcccctgcccctccgccaggg
EXON 2  244 bp
tgacggagatgacaaattcctctaggtgggcacatttctcctggggccaaaggtgctcct
gcagtggaagaagtgttgctattaataaccaatgaccctgagcctcatggtgaatctctt
catgttctttttcttgatgcagcttataacaggtcttgttgcttcctctggtttttctag
AATGCCAGCAGTTACTCTGCAGAGATGACGGAGCCCAAGTCGGTGTGTGTCTCGGTGGAT
GAGGTGGTGTCCAGCAACATGGAGGCCACTGAGACGGACCTGCTGAATGGACATCTGAAA
AAAGTAGATAATAACCTCACGGAAGCCCAGCGCTTCTCCTCCTTGCCTCGGAGGGCAGCT
GTGAACATTGAATTCAGGGACCTTTCCTATTCGGTTCCTGAAGGACCCTGGTGGAGGAAG
AAAG
gtagggagggcggctgctttgtgtatcaagctgggaggagcctctgaaggaggcaacagg
ttgtttgggcaaaatcggggtctggaggttgagaggctgagcttctcttcccaacgccgt
cactgctgtggtcaatttattctattgctttctgcctgaattttcctctcctataaaatg
EXON 3  118 bp
aagacgtagaccagggaattcgaaagacatgaagttcatgttcttccctggaatgcagcc
ttttctatgatgcatgtcaaaggttgcctttggccttggtcatgtgtacttgaacatttg
catatttactgcattagagataaaatgaaatgaatatgaatatgatctgcttttttgcag
GATACAAGACCCTCCTGAAAGGAATTTCCGGGAAGTTCAATAGTGGTGAGTTGGTGGCCA
TTATGGGTCCTTCCGGGGCCGGGAAGTCCACGCTGATGAACATCCTGGCTGGATACAG
gtgagcagccctgcccagggcgcaaagttctctcccgggtgtcaggccagcagtgggaac
agtggagctccttccatcagccccatcacctggagcaggctgtggtctacagcagtagtc
caggggagagagtgacattgagaggctgcacttgccaagggccatatgatgggtggagag
EXON 4  133 bp
gatcgctgcagtgctagcgaggtccggtccctttctgcccctcggggtccccgtggccag
tggttcagctgggaagatgctgggaggcaagcccccgtctctggctcccctctcctgccc
cgggaggtggaggaggagcaggagcccggctgacggcttctcctgtccttggttctgcag
GGAGACGGGCATGAAGGGGGCCGTCCTCATCAACGGCCTGCCCCGGGACCTGCGCTGCTT
CCGGAAGGTGTCCTGCTACATCATGCAGGATGACATGCTGCTGCCGCATCTCACTGTGCA
GGAGGCCATGATG
gtgagctccgccctgccccgccccactccgcccctgccgcctgtccccagcgcccacatt
agacacagcactggccgagtgcccagctgcgagggacccaagggctctgccacgcggcct
gcacagggccagcaacctccctctagcggagttctaacaccagactcgctgttgggacag
EXON 5  51 bp
gctgcaccgtggctagcggcattgtggctagctgcactgtgggtagctgcaccgtggcta
gtggcactgtggctagctgcatcttggctagctgcaccgtggcctgcagtgcgggcatga
ggctcacactgccagtggccgtctgttctgcttccacactgttgtccttgtcccctgcag
GTGTCGGCACATCTGAAGCTTCAGGAGAAGGATGAAGGCAGAAGGGAAATG
gtaagtgggttgtttggtgcccacaagtggtccagaaagtgcatgacgtgcatgtggaag
gtgtgcctgccggggcattttggcattggcttttgtttgttgatttgtttttgccttgcc
ttccgtgtgtgggacaggcaacatttcagggagtgctgtggcctgcagcagccagaggcc
EXON 6  146 bp
gcacctgccccacttggcactgggcagcctggagtgggttcgacttgcgtggcctccacg
tgggccaggcacggtgtgtccagcaggctgagggcggctggcaggtcttcctgcatgggc
catgggaggtggtgagctttggcgggcagctcccaatgtctctcgttctgttgcccccag
GTCAAGGAGATACTGACAGCGCTGGGCTTGCTGTCTTGCGCCAACACGCGGACCGGGAGC
CTGTCAGGTGGTCAGCGCAAGCGCCTGGCCATCGCGCTGGAGCTGGTGAACAACCCTCCA
GTCATGTTCTTCGATGAGCCCACCAG
gtaagtcaggagcatctgagctggtgtccaggggcaggaagaaccccctgtattcagcgg
ttcttccaggtgaccctgacatcctgatgtagcctcagagggggtgagttgagctcaccc
ggcggttcctccttccatctgggaccactgggcagaagagctgacttatgccccctctct
EXON 7  124 bp
ccctgccactgagcagcaaaacaaacagcaagagcagagcccggcctgggacggggcagc
tgcagctgcagcccctgatgccaagccctctgggacaggaactccctggacccccggaac
ctggggcagtggctagttcctgccgcccgcaggcgtctcacggtgcctcttgacttgcag
CGGCCTGGACAGCGCCTCCTGCTTCCAGGTGGTCTCGCTGATGAAAGGGCTCGCTCAAGG
GGGTCGCTCCATCATTTGCACCATCCACCAGCCCAGCGCCAAACTCTTCGAGCTGTTCGA
CCAG
gtacgcgggccccgggccctccccgccagattaccactgcactcaggtcagcctgaatga
caccaaaccctgggtacccactgccttctgttagctcgtggggcgtcttcatgacaccaa
accctgggtacccacagccttctgttagctcatggggcatcttcatgacaccaaaccctg
EXON 8  115 bp
ttcccttcagatgttaatagggcccttgggggtgatgtaaagctctcaggagaggaagtg
gctgatcgctgggctgactgattgatcggttgattgattggttgattgattgattgaggg
ctccggttgccttccgaggaaggcagggcttgatccctttttctccttccttttttccag
CTTTACGTCCTGAGTCAAGGACAATGTGTGTACCGGGGAAAAGTCTGCAATCTTGTGCCA
TATTTGAGGGATTTGGGTCTGAACTGCCCAACCTACCACAACCCAGCAGATTTTG
gtaagcggagtcctgagcagctcgggggacagaaaggggattttcctcctctgtgggtct
cacttttagctgacgcccccaactcagaaaccacttgactaccacaaatagctcaagtgt
catccagttataaaacgtttaaagaacaaaaaaattaggtttcatttcctctagactcta
EXON 9  185 bp
ggggggtttgagagccgcacgctggttgataaatgattttgacgtcatgccattagcacc
gccacgcagcatctatgtaatcgctttaaaacattcccacttgaataacgactttcgcat
ttgggtggttggggtgtccttcctggagcccgggctgacccccgtctgtgtctcctgcag
TCATGGAGGTTGCATCCGGCGAGTACGGTGATCAGAACAGTCGGCTGGTGAGAGCGGTTC
GGGAGGGCATGTGTGACTCAGACCACAAGAGAGACCTCGGGGGTGATGCCGAGGTGAACC
CTTTTCTTTGGCACCGGCCCTCTGAAGAGGTAAAGCAGACAAAACGATTAAAGGGGTTGA
GAAAG
gtaatgcaaatcccgaagccccctgggggaggctgcacgtggcaccgtgcactgctgcat
gagagctctttccgagcaagaaggagccgtggctccggactggctttcacccgctcccct
cttgcgtgtgtcctcaggactcctcgtccatggaaggctgccacagcttctctgccagct
EXON 10  102 bp
tgaagaggtaaagcagacaaaacgattaaaggggttgagaaaggtaatgcaaatcccgaa
gccccctgggggaggctgcacgtggcaccgtgcactgctgcatgagagctctttccgagc
aagaaggagccgtggctccggactggctttcacccgctcccctcttgcgtgtgtcctcag
GACTCCTCGTCCATGGAAGGCTGCCACAGCTTCTCTGCCAGCTGCCTCACGCAGTTCTGC
ATCCTCTTCAAGAGGACCTTCCTCAGCATCATGAGGGACTCG
gtaaggctgcccgcatcttctcctgtagctggggaacccgtgggtcattttctcagactc
gtcctgacggaatgtgttcgttcattctcacattgctataaagaaattcatgaggccagg
catggtgactcatgtctgtaaccccagcactttgggaggccaaggcaggcagatcatttg
EXON 11  169 bp
gtgtgtatgtgagtcgctttagggtttggcttgtttctctggaggagaagacaggataaa
gtctaagacgtgctgtcacagagttcagggtcccatgcttccaaaggccgcatccgggtt
gttctctgagccgaggacggctttgcgaacgcactgggtaagatgcgggtctgtccccag
GTCCTGACACACCTGCGCATCACCTCGCACATTGGGATCGGCCTCCTCATTGGCCTGCTG
TACTTGGGGATCGGGAACGAAGCCAAGAAGGTCTTGAGCAACTCCGGCTTCCTCTTCTTC
TCCATGCTGTTCCTCATGTTCGCGGCCCTCATGCCTACTGTTCTGACAT
gtgagtgacagaccgctgaccccttcttccttattttcaattcctacccaagcatggggg
cctgaagtcacgccttgaccaacagatgagttttctaaacacaatgtttttgttttttta
aaatatcatcttctttgttgacagatgcaagttgtattgtatttgctgttagataagaaa
EXON 12  101 bp
ttatgcaaacgggtggcgtttttcaggctagcaaaacacatcctctgtttgttcaatctc
tcagtgccctaggccagagctgggttaccagccgctcagctcaagatcgcctgttgggat
gttaaacgggctcgctgcacatggtcactgacccttcttttttgcttttctatctcctag
TTCCCCTGGAGATGGGAGTCTTTCTTCGGGAACACCTGAACTACTGGTACAGCCTGAAGG
CCTACTACCTGGCCAAGACCATGGCAGACGTGCCCTTTCAG
gtgtgttagccaggggctggaatttgaaacgggggcaagagttctcctgtacacccttta
tatcgagtaagaggacctgccagggatgcagggtgacatggcccgacttcgggagctctg
gtgggagctgcggggaagggcctgacttcgggagctgtggcgggagctgtggggagtggg
EXON 13  159 bp
agctgcggggaagggcctgacttcgggagctgtggcgggagctgtggggagtggggaagg
acccgactttgggagctctggcgggagctgcggggaagggctggctgcccaggagctttg
ctgttggcctgctgtggtgggaagcggctgagcccgcggctgacgggtccttgtttccag
ATCATGTTCCCAGTGGCCTACTGCAGCATCGTGTACTGGATGACGTCGCAGCCGTCCGAC
GCCGTGCGCTTTGTGCTGTTTGCCGCGCTGGGCACCATGACCTCCCTGGTGGCACAGTCC
CTGGGCCTGCTGATCGGAGCCGCCTCCACGTCCCTGCAG
gtgccagcccaggaggcgctaagtgagggcatgacggctgggcttccctgagctaccttg
gcctgagctagggggctctgccaccccttcccctacttctgccctgaccctcctagatgg
ggtcgttcccacgggaagggcccgcattgtcgagggtcaggatcagctggcttccacagt
EXON 14  119 bp
tcagagatggtgaccccacacctcgggaacgctgcaccttctgccacattaagcatcatc
attaccctgcccagaaggtgccctggccctgcccgggggaagctggcgtgggcgagcctc
ctctgcaggaggccaggctgcaggttctgctacatctgtcctgtgtgcccccaactccag
GTGGCCACTTTCGTGGGCCCAGTGACAGCCATCCCGGTGCTCCTGTTCTCGGGGTTCTTC
GTCAGCTTCGACACCATCCCCACGTACCTACAGTGGATGTCCTACATCTCCTATGTCAG
gtagcgggcgtggggcacgcatggcgtggggaccgagggtgacgggggaagaaccgtctc
caacagcgtgaggggctcacaaaagccactctgggctgctggccaagagcagattacaca
tctgaggatccaggccttccatcttcctgctagttccacctcctcctaccctcaccaaca
EXON 15  1079 bp
tgcacgtgtttgtcttaagaaggtggtgggcggtgaggaagtattctggggaaggcggcc
ctttgggaagggaggatagccaagctgggaatcgcagggagggtgaacgacattgacctt
cagccaacggcgtggctggctgggagaacgtcctccctcatgcctggcctttcctcctag
GTATGGGTTCGAAGGGGTCATCCTCTCCATCTATGGCTTAGACCGGGAAGATCTGCACTG
TGACATCGACGAGACGTGCCACTTCCAGAAGTCGGAGGCCATCCTGCGGGAGCTGGACGT
GGAAAATGCCAAGCTGTACCTGGACTTCATCGTACTCGGGATTTTCTTCATCTCCCTCCG
CCTCATTGCCTATTTTGTCCTCAGGTACAAAATCCGGGCAGAGAGGTAAAACACCTGAAT
GCCAGGAAACAGGAAGATTAGACACTGTGGCCGAGGGCACGTCTAGAATCGAGGAGGCAA
GCCTGTGCCCGACCGACGACACAGAGACTCTTCTGATCCAACCCCTAGAACCGCGTTGGG
TTTGTGGGTGTCTCGTGCTCAGCCACTCTGCCCAGCTGGGTTGGATCTTCTCTCCATTCC
CCTTTCTAGCTTTAACTAGGAAGATGTAGGCAGATTGGTGGTTTTTTTTTTTTTAACATA
CAGAATTTTAAATACCACAACTGGGGCAGAATTTAAAGCTGCAACACAGCTGGTGATGAG
AGGCTTCCTCAGTCCAGTCGCTCCTTAGCACCAGGCACCGTGGGTCCTGGATGGGGAACT
GCAAGCAGCCTCTCAGCTGATGGCTGCACAGTCAGATGTCTGGTGGCAGAGAGTCCGAGC
ATGGAGCGATTCCATTTTATGACTGTTGTTTTTCACATTTTCATCTTTCTAAGGTGTGTC
TCTTTTCCAATGAGAAGTCATTTTTGCAAGCCAAAAGTCGATCAATCGCATTCATTTTAA
GAAATTATACCTTTTTAGTACTTGCTGAAGAATGATTCAGGGTAAATCACATACTTTGTT
TAGAGAGGCGAGGGGTTTAACCGAGTCACCCAGCTGGTCTCATACATAGACAGCACTTGT
GAAGGATTGAATGCAGGTTCCAGGTGGAGGGAAGACGTGGACACCATCTCCACTGAGCCA
TGCAGACATTTTTAAAAGCTATACAAAAAATTGTGAGAAGACATTGGCCAACTCTTTCAA
AGTCTTTCTTTTTCCACGTGCTTCTTATTTTAAGCGAAATATATTGTTTGTTTCTTCCT
aactttctgactacctttaattttgcctaggttgatttaaacaaacaaacaaacagcttc
cctttcctcctgtatcacctcagctgcctccactgaacctggaagaatggggcttaggga
aattcaggcacgacctttgagggttggctcagcaggagtggccagcagtgaaagatgggc