--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (16967 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1179       1274   2   Internal     96    90   Excellent
cagggggcgcgggttcccaggaccgaaaaggcggagcctcccacgcgcactacgtgctcc
ctacgcgcatgcgtcccgcccacgcgcaggcagcacctcgcctgactgggtagcgctgcc
acgtcggggcggggaagagcgtcgtcgcgtccgggtgacgtctcccgagggcgtcggcag
GGTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGA
GTATCTGGCCTCCATCTTCGGCACCGAGAAAGACAA
gtgagtgggagccccccgccgggggttgggcgcgatcggggcgcagggtggttgaggcgg
tgggagggcgaccggggaggcccaggcgggccggcgcggcggtggcgggggaggggcgcg
cggcgggaaggagcggtggcccttccggccccttgcgcgccctccggagccgccgcctcg

Exon  2 +       7293       7359   0   Internal     67    56    Marginal
actgctcaaactctgttttcataatatgatggttttggtgtactcttcagaagacaaatg
tctgacttgcgggaaaaaaacaaacgtttagccatttgcaaacaaattgtctctttgcaa
ttgtctaatatatgcacagcagccagtagaattcccctttttatttttttttccccgcag
ACCATCTTGATTCAAAACATCTATCGTAATCCCCAAAACAGTGCACAGACGGCTGACGGC
TCACACT
gtaagtcccacagttggagaaatttttttaaaacaatggtgttaaagagcccactcttaa
ttgagacaaataatgttggcttctgagctgctgacatagagctgttgcaaacaggacaag
gtgctggaactccttggcgcacacagcaagaacttgatacttggccacgttcaggaggct

Exon  3 +       8206       8272   0   Internal     67    69    Marginal
tacaccgcagtgttagggattcaaggcagccgccaactgagaaaacgcctctgcttctcc
agaaaataacttgctctcttttcagcactgaatctcaactgaagcacttgccagaggcag
ccggttaagtgtttacctttaattttccataatataaagttgttgcgttttgtatttcag
ACCATTGCCCTCTTGAACATTTACCGTAACCCTCAAAACTCTTCCCAGTCTGCTGACGGT
TTGCGCT
gtaagttcatacaagttccttccccggttccctgggcttgcgtgtcagagctcagtgtcc
actccatctggtctgccgtgctagtgtcaaggaccgcgtttcactagaggtggcaaggag
ctttcgtcccactgaccccatggaaacctcttttggagatttgaactcccaccgtgtgtt

Exon  4 +       9547       9641   1   Terminal     95    53    Marginal
gatgagtatgattgggaagttcagaaaactaaaatttgatttttacagccatccaactat
agaatcattagaatttagtcatttatggataaattaaaatgaacacctggactcttgtta
aaatcagaaagtccaaaccaaagataggcacttcccattcaccattctgttttaaagcag
TAAAAATTGAGGTGCCCTTGGATATCCACAAGCCTAAATTGAGTACACCCTTGAACCAGA
GCCCCTCAGTTAATGGGGTGACCGACATGGGGTAG
ctgatcccagggggcattcccctctcgagctggccctgcactgggtggcctggggattgt
gcttccttgcacagtggtgcacatttctatgtgtggatgagattttcttgtcaacttttc
ctgccaagacactaaatgcttttcagtgctaatactgacctgatagtagagatttctttc

Exon  5 +      12699      12829   1   Internal    131    53    Marginal
tcgcctgtagtcccagcaactccagaggctgagacaggagaatcgcttgaaccccagagg
tggaggttgcagtgagctgagatggtgccactgcactccagcctgggcgacagagccaga
ctgcatcttgtgggtgtaaaaaaaaaatttgtagtttgagagtcaactttttcctcacag
TTTCTGAAAATGTGGCCCTTTTGATGCTGATTAAAGCTGGTTGTGATTTTAACACCTTAG
TAGCCAGAATCGAGACTGTCATGGGGACATTTAAAATCTCACCACACTTGACACCATTCA
CAAGTAGCCAT
gtggctcagtctcctgagtgctcctgcagagtgcagctctgccaggcttttctctagata
atctcgtgtgtgttactgtagcagtttgagtttaaacacaagagttcactcggttaacat
gttctaaccagcaagatttctgttgtttgcaggtgccgtgagcgatgtggagatgcagga

Exon  6 +      12982      13031   1   Internal     50    93   Excellent
acacttgacaccattcacaagtagccatgtggctcagtctcctgagtgctcctgcagagt
gcagctctgccaggcttttctctagataatctcgtgtgtgttactgtagcagtttgagtt
taaacacaagagttcactcggttaacatgttctaaccagcaagatttctgttgtttgcag
GTGCCGTGAGCGATGTGGAGATGCAGGAACACTATGATGAGTTTTTTGAG
gtgagagaactgaactctgtgactgatagacctgttgatcttctgtatctgtttggaagg
atttaaaatgtttctctgctaataaacatacatgagttatatctaatgacactttgtaat
gtataacgagtcttaaaccactgtggtctcccttcaggaggtttttacagaaatggagga

Exon  7 +      13189      13287   0   Internal     99   100   Excellent
aacactatgatgagttttttgaggtgagagaactgaactctgtgactgatagacctgttg
atcttctgtatctgtttggaaggatttaaaatgtttctctgctaataaacatacatgagt
tatatctaatgacactttgtaatgtataacgagtcttaaaccactgtggtctcccttcag
GAGGTTTTTACAGAAATGGAGGAGAAGTATGGGGAAGTAGAGGAGATGAACGTCTGTGAC
AACCTGGGAGACCACCTGGTGGGGAACGTGTACGTCAAG
gtaggagccagggcgagacggcggcgtggccgcttagtgtgccagggccaaggccaacag
gcgaaagcgagacagtggtgcagccgcttagtgtgccggggccaaggccgacagaggatg
gggtgcctgtcgccatgcaccttgagatcctggatgctcaggcgcacagcagggctcagg

Exon  8 +      13422      13586   0     Single    165    65    Marginal
ctgtgacaacctgggagaccacctggtggggaacgtgtacgtcaaggtaggagccagggc
gagacggcggcgtggccgcttagtgtgccagggccaaggccaacaggcgaaagcgagaca
gtggtgcagccgcttagtgtgccggggccaaggccgacagaggatggggtgcctgtcgcc
ATGCACCTTGAGATCCTGGATGCTCAGGCGCACAGCAGGGCTCAGGTGCACTGGCTCGGC
GCCTACCAGCTGCGTCATATGTGGCGGTGGCCAGCCCACACGTGCGCCCAGCCAGCAGAA
CTGAAGGACGGACCGTACACCACAGCCATCGTTATTTCAGTGTAG
aatatttagtacctgttggtttagaagctgtgtggactaaggaaaagttaggtttactca
catgtttggtttcttttttcttttttagtgaataaaactttatttgcctacacagccata
tttgctcctttaaccagttgaatttgaaaaatgaaggcaacatttggcaaaatcttggac

Exon  9 +      13937      14070   0   Internal    134   100   Excellent
aatcttggactatcttgaagttaatctcattgaaaataaaggatttttcaattatcctgt
aatactattccaccttactatacctgagtgtgtatatctctctctgatatacttggattg
gtaattgagaaagtcttattaaagcgtggatggcaagcacttctgtttttgtcttttcag
TTTCGCCGTGAGGAAGATGCGGAAAAGGCTGTGATTGACTTGAATAACCGTTGGTTTAAT
GGACAGCCGATCCACGCCGAGCTGTCACCCGTGACGGACTTCAGAGAAGCCTGCTGCCGT
CAGTATGAGATGGG
gtgagtgaggagtggccagtgacgtgactgagcacagttcggggccgtgtgcacacgagg
tagtaaatgtctccttccaacccacccacagagaatgcacacgaggcggcttctgcaact
tcatgcatttgaagcccatttccagagagctgcggcgggagctgtatggccgccgtcgca

Exon 10 +      14162      14254   2   Internal     93    94   Excellent
aaccgttggtttaatggacagccgatccacgccgagctgtcacccgtgacggacttcaga
gaagcctgctgccgtcagtatgagatggggtgagtgaggagtggccagtgacgtgactga
gcacagttcggggccgtgtgcacacgaggtagtaaatgtctccttccaacccacccacag
AGAATGCACACGAGGCGGCTTCTGCAACTTCATGCATTTGAAGCCCATTTCCAGAGAGCT
GCGGCGGGAGCTGTATGGCCGCCGTCGCAAGAA
gtgagtattcctgtgcccgttgttaagctcagtggcttctttctcccctcacaaccctcc
cccttccaaaaaaaaaattttggcataggtgtcgtttctgttttttaaaaggcagtgctt
agaacatagtacatatttttaaatatccaaatgtcctctttggagaagaatattcacctg

Exon 11 +      15066      15154   1   Internal     89    76        Good
aatcaggcccagcggtcacatctctctgatcctacatttaaatgtacgacaggtcacaga
gcagagaaaatcaagacgtcagaatcgaaccgattgagttctgagtctggagaggttctc
atccctcttctgttaaacatggactagtaaatagatgggtggcgattgttttattgtcag
CATTCAAGAAGCATAAGAGAAAAACAGGCCTGCTCTCCCCAGCCCAAAAACCTGATGGAC
ACAGTAGCTATGAGCGCCTGAAGCGTGGG
gtcagtgagggttgaagatggtatgtgtccagctcattttgattatgatttcctgtgacc
atttgagttggttctagaagaagacagaagatgcaaggtattacacctgttcacttctaa
gttgcacatttttttctcctgaaacttttcacacctgaaatcagggtgtgtctcagtcac

Exon 12 +      15476      15669   1   Terminal    194   100   Excellent
aaacttttcacacctgaaatcagggtgtgtctcagtcacggcgtgcagtctcttcagcag
tgtttttccttatcagtgccgttggcttgaggagctgcgcgtgttgagagagtgggtgtg
gttctgtgctgcgtgccgtggtttggatggcacggttttctttattttccttggttgcag
GCATAGATCAAGATCCCGATCCCGGGAGCGTCGTTCTCGGTCTAGAGACCGTGGTCGTGG
CGGTGGCGGTGGCGGTGGTGGAGGTGGCGGCGGACGGGAGCGTGACAGGAGGCGGTCGAG
AGATCGTGAAAGATCTGGGCGATTCTGAGCCATGCCATTTTTACCTTATGTCTGCTAGAA
AGTGTTGTAGTTGA
ttgaccaaaccagttcataaggggaattttttttaaaaaacaacaaaaaaaaaaacatac
aaagatgggtttctgaataaaatttgtagtgataacagtattcttggtgtaacttatttc
ttgtggaagttctttaaatttctttttctttataaatctgctagtcatcttggaggtaaa

--------------------------------------------------------------------------------