--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (26600 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1289       1350   2   Internal     62    58    Marginal
tggaattctttcgtaggaaacacagccccggggttattttgatgcaagccgttggtccaa
agccactccccactttgctatgtgggggaaggaccgggcaccggacggctcgggtacttt
cgttcttaattaggtcatgcccgtgtgagccaggaaagggctgtgtttatgggaagccag
TAACACTGTGGCCTACTATCTCTTCCGTGGTGCCATCTACATTTTTGGGACTCGGGAATT
AT
gtgagtaccgaaactacttatgcttatggtaggtgtaccacacgcacagggaaagaattg
cgtttatgtgggacaggtgaaaacaatcgcaaaaaagcaatggaaagggctttgagagta
atttatcttctgaacaatagcaatatggcaacttctaaatggtgagagggagtccctcta

Exon  2 +       1383       1511   2   Internal    129    52    Marginal
cgggcaccggacggctcgggtactttcgttcttaattaggtcatgcccgtgtgagccagg
aaagggctgtgtttatgggaagccagtaacactgtggcctactatctcttccgtggtgcc
atctacatttttgggactcgggaattatgtgagtaccgaaactacttatgcttatggtag
GTGTACCACACGCACAGGGAAAGAATTGCGTTTATGTGGGACAGGTGAAAACAATCGCAA
AAAAGCAATGGAAAGGGCTTTGAGAGTAATTTATCTTCTGAACAATAGCAATATGGCAAC
TTCTAAATG
gtgagagggagtccctctaaagcaatcgatttgaagattggttggacaaacaatgggaaa
gtcattgtcttagcagaattaagttcatactttttttttttttttttttttgctaattct
agaagcttttctgttatctgctgtagctcagacgaaaatgcattctcaccagatgactgt

Exon  3 +       1658       1968   2   Internal    311    69    Marginal
ttctgaacaatagcaatatggcaacttctaaatggtgagagggagtccctctaaagcaat
cgatttgaagattggttggacaaacaatgggaaagtcattgtcttagcagaattaagttc
atactttttttttttttttttttttgctaattctagaagcttttctgttatctgctgtag
CTCAGACGAAAATGCATTCTCACCAGATGACTGTTTTTGGTTAATCGATACTGAATGCGC
TTTGTGTGGACTGTCGAATTTCAAAGATTTACCGTATGACCAAGATGCACCTGATGCTAC
AAGTATAAATAGGGGAACAAATGCTTTCTGTTCTTCCTCGGCTAAGGAGGTAGAGGTGGA
GGCGGAGCCGGATGTCAGAGGTCCTGAAATAGTCACCATGGGGGAAAATGATCCGCCTGC
TGTTGAAGCCCCCTTCTCATTCCGATCGCTTTTTGGCCTTGATGATTTGAAAATAAGTCC
TGTTGCACCAG
gtaagtggacccaggtgaggactctgtgatttctgcccataccctcatgtaggtgaccaa
tgtgactgactgtccctgtgggggaaatatctccccagccattctgacacccacaggctg
gacacctgcacttccctagatctgcagaatctcagggagaaggggcattggagaggggat

Exon  4 +       4332       4442   0   Terminal    111    49    Marginal
tcctgagttgctggaattacaggcacatgcccccacacccagctaatttttgtattttta
gtagaggcgggtttcaccgtgttgggcaggctggtcaagaagttgaaagctttttcatac
ttgtgcgccatttgcattccttctttggagaaatgctgtacatttcattgtttattccag
GCAATGTCCTCAAGGACCAAGCACAGAGGAGGCGTGGGGCCCCTGCAGTGCCCTCAGGGC
AGCCTGACAGAGAAGCAGGGCAAACGGGAACTGACACAGCCTTTCGATTAA
atgtcaatctttgatttgacaatttggggtcattttctaaatccaacttaaatacagagc
agctggaatgtgaagatgtcattcctggggttcctgcagatttctaagtataagacgaag
ggtgggcatccttatagaggagaattgttagtgtgcgggggatcgaggtgtgagggtgga

Exon  5 +       7255       7365   1   Internal    111    99   Excellent
aggactgaactagagaatgtgccccttggtgggtggccctttccctaattaaggcacctt
tctttgggctgagacttctctgcaaagaggggagggggaaaggatagttaaatttgtaag
tttcatggcactccaagtcaggttctgtggctttctgctcttcctttttctggttttcag
ATGCAGATGCTGTTGCTGCACAGATCCTGTCACTGCTGCCATTGAAGTTTTTTCCAATCA
TCGTCATTGGGATCATTGCATTGATATTAGCACTGGCCATTGGTCTGGGCA
gtgagtacaattcattatttagtaggatctcaaatacctagccaagtagttaaactttca
tgagcgccccctctcatcccagcattttgctgctgcccagccttaattactggaggcaaa
catccttttggtttgctgacttgaagttttatttgcccacatgaatgtaaagtcagtctg

Exon  6 +       8247       8433   1   Internal    187    95   Excellent
accccttggaattcaaaacagaaactgggctgcaggaaacaggctgctgacagggacgca
atttcaatacaggtttcattattcacgggccagctccgcactgtgtggcagggggacagt
tgttagtgttgcactctgaaagagctgttggttaattcctgccttcctcccttttcccag
TCCACTTCGACTGCTCAGGGAAGTACAGATGTCGCTCATCCTTTAAGTGTATCGAGCTGA
TAGCTCGATGTGACGGAGTCTCGGATTGCAAAGACGGGGAGGACGAGTACCGCTGTGGTA
AGGTCATGGCTCTTCCCCTGGGGAAACAGAAGGAAGCAGCAGAAGCCAACCCTGACCCTT
CCCATCT
gtaaaatgggtccaagtcattgccatttttaggtcatgtcttcagctgggattgaactgg
cgtttgcccaaagacatgttgggctggggggtcagggagggccttccatggagctctggc
tctcttggggagaccacataagcaataagatgagaccagcgagaagtctcagggatccag

Exon  7 +      11183      11293   2   Internal    111    93   Excellent
gaagaaatcctgttgataagctggtgtgttcactatgaaaacaagcctactgtactgtgt
tttgttcatttcacaagggaaggagaacatggctgtttattcaccatcttccatcttgtg
actctccaaacatgtgattcttctttaaaaagttgcatcactttcaccactgttctccag
AAGACCTGTGTCCTGGCACTGTAAAAATGAGCTGGGCTCTGGTGTTCGTGGAATCGCTTT
CTTGTTTGTGTTCATCTCTTTCCAGTGGGGCTCTGCGCTGGTCCTGGGCAG
gtgagggatgtctctcctgttcctccaactcactgttcttggagaacttggtgtccctgc
ttgggtgccccccgacaatactgcacctagttttgtgctcacctcccctctggacttgct
tcaggccaagcaaaaggcatttcactggaatgcgcaaagagtgactcaaccaaggacata

Exon  8 +      11758      11887   2   Terminal    130    79        Good
gaatgccttgccagggtgagtgaacttcattctcttggcaaaggaagcctttgatgggtt
tggggggacaaaatgacatcccccatgtacaatccctgtaatattgtgactcgcacatcg
gttgaatgcttcaaagtgtaaagttaccacgtcgggtctgtctttccaatgtgcttgcag
CTATGTGAGTTCAGATAACCTCAGAGTGAGCTCGCTGGAGGGGCAGTTCCGGGAGGAGTT
TGTGTCCATCGATCACCTCTTGCCAGATGACAAGGTGACTGCATTACACCACTCAGTATA
TGTGAGGTAG
gtggtcaggcgatgctgttgtctgcacaggtatcgagtcacctgctggatttgtgatgct
atgcacaactccacaaggacttaagaggcatgcatgtgttatctcagatggaaggtggga
gttggccaccttgatgagactggtggatgcgccaggctgggggtgtgagaacctgaggga

Exon  9 +      13441      13571   1   Internal    131    72        Good
actttttctccgctttagggagggatgtgcctctggccacgtggttaccttgcagtgcac
aggtaagagttccagaaaggcaggggtccagggggagcaagcacatgctaagtcctatct
ccttgccctcagagtcctctccccccatggggctctgtatcccttcctcctgggtgccag
GCGGGAACTCTGTGTACCCCTACCTGCTGGAGGAGGGGAGCAGTGTCATCCTCACCTGTC
GGCCTCACCTGTCAGGTGGGGGAGACAGCCAGAGCAACTCATTAGCAGCGGACAGGACCA
AGGCCCATGAT
gtcccatcactctgaagagccttgagtccctgactcagttcccacttcctccttacacgt
gcacagtgcccactccaggcctcgggcagtgcccctcgttcctggcagaggggagtgttc
acaccacaagggtggggtctggagcagtcagggaggtgcgtgcaccagcggcagtgagga

Exon 10 +      14141      14259   0    Initial    119    60    Marginal
tcttagagctgctgtgagctctgggagcaggggcagtgagggtggggagagaggagcagg
tgcatggtggtgacaccatgtcccccaaagaagtctgcagggtggacccacaagcctttg
ttcccctccatagcctgtggtcatagaaggggctacagctcacgcatcgtgggtggaaac
ATGTCCTTGCTCTCGCAGTGGCCCTGGCAGGCCAGCCTTCAGTTCCAGGGCTACCACCTG
TGCGGGGGCTCTGTCATCACGCCCCTGTGGATCATCACTGCTGCACACTGTGTTTATGA
gtgagtgctgctgaccatcttcccagacccctgttcactcctgggtcatgtcagggtggg
gctgctttgggtggtgagaagcgggtccagagggaagacagagagactaacctccaagta
atgtacagttggagaggagtctccagcctcactgtggacccatcatcatcagctgggggt

Exon 11 +      15058      15227   2   Internal    170    99   Excellent
tgtgtttctgtagggcgtggcagtgcagttgcatatacagcataaacaagcagggtgatg
ggaccacatcttgcctgataacctctcccaccatcttcctaggttttcaggatacctgag
gtcaatgagttcagtggttggacttttcctgtgcttcacctcttgctcttctcatttcag
CTTGTACCTCCCCAAGTCATGGACCATCCAGGTGGGTCTAGTTTCCCTGTTGGACAATCC
AGCCCCATCCCACTTGGTGGAGAAGATTGTCTACCACAGCAAGTACAAGCCAAAGAGGCT
GGGCAATGACATCGCCCTTATGAAGCTGGCCGGGCCACTCACGTTCAATG
gtacatctgggtctctatgtggttctgcagctcttcctttgtttcaagaggatttgcaat
tgctcattgaagcattcttatgatggctgctttataatccttgtcagatattaataattc
caactcctgattcatgttggtgttggcatcagttgattatcttttctcattaaaattgtg

Exon 12 +      17759      17835   0   Internal     77    90   Excellent
tcatcctacaaagagcaagtggaagcagcagcagatgagatcgctgtaataataagggaa
gtaggagtggcagtaaccatagtccatgcaaatgaagcccgggccaccctttccttagtg
tgggtacagagctggtcatgagtcttaggtttttccatcaatcactttctttgttagtag
GAAGAGGATTCATTTTCCGTGGCTGCCGTGACAAATTATCACAGTCTGCGTGGCTTAAAA
CGATGGAAATTGGCCAG
gtgtgttccctcacacctgtagtcccagcattttgggaggccgagtctatgggatccctt
gaggccattagtttgagaccagcctgggcaacatagagagacaccgtctctacaaaaaat
acaaaaattagccaggcatggtggcatgcacctgtaatcccagcactttgggaggccaag

Exon 13 +      20609      20751   1   Internal    143   100   Excellent
cgagacagtgggagtctgctcgtcccacccgcagggccctgtccttttccgctgttgcga
cacaccagagagcatccccctcgtccctcgttccctcacccccctggtctcagcatgcgc
cttctgtgttttgggccgggcttccttctcacacacatcccctcactcactttgaagcag
GTGACGCCTCCCCTGTCCTGAACCACGCGGCCGTCCCTTTGATTTCCAACAAGATCTGCA
ACCACAGGGACGTGTACGGTGGCATCATCTCCCCCTCCATGCTCTGCGCGGGCTACCTGA
CGGGTGGCGTGGACAGCTGCCAG
gtacggggccgcagcggtgggcgaggccgtggcagggtgacccagcccttgggacaggtc
gttgccagcgtttccctgtgacaggacaaaaagtaaatttacagggcgtggagaagaaat
ttgctcaagatatcactccttttcctggctgccagccctgtgtttacccagtgatctggc

Exon 14 +      21424      21576   0   Internal    153   100   Excellent
gggatgctgtgtctggaagggctggtgggttcccttctgtaacctgggtcatccattggg
acatcatgaaggggggtcccaactccatagcaagcagcctcacacggcagactgtccaca
gaaagcaatctcgcatggcggtgactgtcccccaatctttgcttctttcctgtcacccag
GGGGACAGCGGGGGGCCCCTGGTGTGTCAAGAGAGGAGGCTGTGGAAGTTAGTGGGAGCG
ACCAGCTTTGGCATCGGCTGCGCAGAGGTGAACAAGCCTGGGGTGTACACCCGTGTCACC
TCCTTCCTGGACTGGATCCACGAGCAGATGGAG
gtgggtgcggcgccctccccagctcacgttgtccctggcttttgaccctaaggtccctta
aatgcaaccctggtcttgctataaaaaccagggcgtgacccagtggttgtcaattcagca
gcagtgacttggtggctccagggtgtcagacgcttgtgctgaaaacagagatcacagcta

Exon 15 +      22139      22251   0   Internal    113    65    Marginal
ccttgcctgcctgctgaggggctggaacctcgctgggagccagggatgagaggcagcagt
caggagaggcttggggagctctgcattggtggtgtgggggggtggggggtcccggagggg
gaggcgtggaagtgggaggggcctgcaggggggcacccaacagcgaggctggcttggcag
GACCCGGGCATGGAGGGGAAACCTGAGACGGTGGAGGAGGAAGAAGGAGGCTTAGGGCTT
CGCTGGGACCCTGGCAGCTGCGTGCTGGCAGGTGAACACGGCGCCTTTCTCAT
gtgggcgccggggaaacatttgctggcttgatctcagatgaagtctctccttgggatggt
ttcaaacacaggaggtcctcacttaatacggttgatgggatcttagaaactgcagcttta
ggagaaacagtgcgcacaggccctccagcaacgtccttgcttgcaatgtaattttgttat

--------------------------------------------------------------------------------