--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (11370 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5256       5384   1   Internal    129    49    Marginal
caagattaccatctcccttttgaggacacaggcctagagcagttaagcagcttgctggag
gttcactggctagaaagtggtcagcctgggatttggacacagatttttccactcccaagt
ctggctgctttttacttcactgtgaggggtaaaggtaaatcagctgttttctttgttcag
AAACTCTCTCCAACTTTGCACTTTTCTTAAAGGAAAGTAATGGACCAGTGAAGGTGTGGG
GAAGCATTAAAGGACTGACTGAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATA
ATACAGCAG
gtgggtgttgtgctgtgctggtgacccatacttgttcaccctagttagataaacagtaga
gtagcccctaaacgttaaaacccctcaacttgtttttgtttttgagaaagggtcttgctc
tgtcgctcaggctggagtgcagtggcgctgtgcgatcatggctgaccttagccttgacct

Exon  2 +       7947       8082   0   Internal    136    53    Marginal
tggccatagacttgtttctgttcccttctcactgtggctgtaccaaggtgttgcttatcc
cagaagtcgtgatgcaggtcagcactttctccatgggaagttttagcagtgtttcttttt
agaatgtatttgggaactttaattcataatttagcttttttttcttcttcttataaatag
GCTGTACCAGTGCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGG
ATGAAGAGAGGTAACAAGATGCTTAACTCTTGTAATAATGGCGATAGCTTTCTGGAGTTC
ATATGGTATACTACTT
gtaaatatgtgctaagataattccgtgtttcccccacctttgcttttgaacttgctgact
catctaaacccctgctcccaaatgctggaatgcttttacttcctgggcttaaaggaattg
acaaatggggacacttaaaacgatttggttttgtagcatttattgaatatagaactaata

Exon  3 +       8756       8873   2   Internal    118   100   Excellent
tctttcttcccagagcattagtgtgtagacgtgaagccttgtttgaagagctgtatttag
aatgcctagctacttgtttgcaaatttgtgtctactcagtcaagttttaatttagctcat
gaactaccttgatgtttagtggcatcagccctaatccatctgatgctttttcattattag
GCATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTAT
TGAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTG
gtaagttttcataaaaggatatgcataaaacttcttctaacatacagtcatgtatctttt
cactttgattgttagtcgcggtttctaaagatccagataaactgtacttgcagttcaaat
taggaaaagcaattttattggacaattacggtgaaaatgaattattttatctaggtcagt

Exon  4 +       9969      10055   0   Internal     87    91   Excellent
caagaaaaagctttgagtagtagtttctacttttaaactactaaatattagtatatctct
ctactaggattaatgttatttttctaatattatgaggttcttaaacatcttttgggtatt
gttgggaggaggtagtgattacttgacagcccaaagttatcttcttaaaattttttacag
GTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGA
AACGCTGGAAGTCGTTTGGCTTGTGGT
gtaattgggatcgcccaataaacattcccttggatgtagtctgaggccccttaactcatc
tgttatcctgctagctgtagaaatgtatcctgataaacattaaacactgtaatcttaaaa
gtgtaattgtgtgactttttcagagttgctttaaagtacctgtagtgagaaactgattta

Exon  5 +      10776      10884   0    Initial    109    74        Good
tgtcctttgaaagctttagggaaatgttcctgcttagtcattttagcattttgattcata
aagtacctcctcattttaaaaagacattatgatgtaagagagccatttgataacttttta
gtgagctttgaaaggcaagttacagcctcagctagctagtaagattatctacctgccaga
ATGGCACAAATTCTACATTCAAGGGTAGACGCTGGCACAACCTACTTACAGATTAGCCCT
TTAAAGCAATCTGTAGCATTAGAAGATGGAACCAAGGAAATGTTTGACT
gtgggttctggctgttgagaaataatttacacaccgaattagtgaaatgagtcactttct
cttaatgtatttatgtacctgagagaatgcttttcaatgttaacctaactcaggtttgac
taaattattcaattggaaattgtagaatattatttctgataaaccagaaataagtgaaat

--------------------------------------------------------------------------------