--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (66013 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1215       1448   0    Initial    234    55    Marginal
ccccaaggcatctctgcacaggtctccgattggtgcacagcacagcctggccttttaggg
actgttgtcgcgcgtttaaagtgatagggaaagggtccagtggctgcttttatcgaccaa
tcaaatattttcctgacagatcccaaaatattcctgggccaatggagggaggagcccaag
ATGCCTCTGCTGCTCCTTGGAGAGACAGAGCCTCTTAAGTTGGAGCGGGACTGCCGGAGC
CCAGTGGACCCCTGGGCTGCTGCCAGCCCCGACCTGGCACTTGCTTGCCTGTGTCACTGT
CAGGATTTGTCTAGCGGCGCATTCCCTGACAGGGGTGTGTTGGGGGGAGTCCTCTTTCCA
ACTGTCGAAATGGTTATCAAAGTGTTTGTTGCTACATCTTCTGGGTCCATAGCG
gtaggtgtctggtggactctttcttcctatactcttttctgaataacttagggttggaaa
tatggccaacgttggccttcagtttcttttttgcgtgtagtcagctgtggctctgcaata
agtatgtgcgccctttgctttctgcatttgatttcatagtgttgaaaaagcatggaaagg

Exon  2 +       2348       2501   2   Internal    154    52    Marginal
tctctttggaaatgggtcagactttgattttaggcttgaacctatatagtgtctgtctgt
ctggaactgatatttcgaccagcattttagcagcagttaggaaggctgtggagagaaaaa
acagttttattaaacccaagagttagagaccagcaaggcggctgttccttttatatctag
TTTCTGGAGGATCTCAGGTTTCGGCTGGGATTTCAGCAGCCACTCTGCCAGAAACAGTAC
CCAGAGTAAGCCATTGGCTGGGGTGACAGCCCCAAAGGCAGCCGCTGAGTGCCACCACTC
CCAGCCCCGAAAGTTCATGAGGTTTCCAGAGAGG
gtgagaagaaagcaagagaaaatagcttggctgtcccttttgctaagtacaactgagcag
ctattgttttagtgatctctagaacaaattagccgaaaaagatgagaacacactccaaat
gtgaaactctgcgaaatcttttgtggctattgatgactgctgaaactttcagttgatcta

Exon  3 +      11682      11867   0   Internal    186   100   Excellent
ttaaatagtcatttggttgaccctttataacaaagaggtgtgattctattattttccttg
tttgaatacttaacaaaattatttgtgttgtatagtataactagaggaaggatttaattt
ttgtaaatgtaagcaaaatatttttcataaacagcctaatatttctctactcttgaccag
ATTAGGAAGAAACAGCAAGAAGTAGTGGGTTTTTTGGAAGCGAATAAAATCGACTTTAAG
GAATTAGATATTGCTGGAGATGAAGACAACAGGAGGTGGATGAGAGAGAATGTTCCTGGA
GAGAAAAAACCTCAAAATGGGATTCCTTTGCCTCCCCAGATCTTCAATGAGGAGCAGTAC
TGTGGG
gtgagtatgtgcttctattaaaaatcctgctgtgtgtgtgtttattagaaattttctaaa
gcagattaagtttgagtcagcatttgaaattattcacaactgtcaggtcatggtctattt
ctgccatccaatagctggatggtagatccattatgaataatcaatatttaagatttagaa

Exon  4 +      14722      14812   2   Terminal     91    80        Good
ccttcccctgagccaggctggctctgtgggcctgtgatctgggataccacacaggacccc
atccacaggagggctctgtacttgtttaatgttctcctattgctgtcttgaaattctcaa
ccatttttgaaggaagggcctcatgttttcatcttgcactggctcttttgaattctgtag
CTCGTCCTACTCTGAGGCAGCCAGTGTTGGCAATTTCGTGTTTGGGTTTGCAGAAATTTT
CTATGTAGATTTACAACTGAATGTCATTTAA
aaaatcagagtgtatcatatacgactttgttttcttgacttaataactgcatctcagagt
tcacagtatagctgcccatgcttattttatttgttttaattttatgatagggtctcactg
tgtcacccaggttggagtgcagtggcgcaatcatagctcactgcagcctcaaactcctga

Exon  5 +      23651      23728   2   Internal     78    66    Marginal
caccatgttgcccaggctagtcttgaactcatgttcaaggaatcctcccaccttggcctc
ccgaagtgctgagattagaggcatgagccaccacgcctggctggttttaagctttttgaa
catacactaagagtagggtaggcaaagaacaactaagttggtttgtgtgttgccctgtag
GACAAACACCTGTGACTTTGTGAGCCTTTTTGCAACACTGTTGAAATTGCATCAAGGCCC
TGATGATGAAGATTGGCA
gtaataaagtagtctgggggaatatcgtttatgttttaattataaaaattgaaactcttc
taagctattgacagctgcattactgggaaggtggtttagggctggacctgcctggtgaag
gactggccctggtaggatctggatggggtggtagcttcattgagcatcagatttcaatcc

Exon  6 +      24442      24522   0   Internal     81    95   Excellent
taaagttcatggttagatttcttaactctggaggttagtcatctttgataaagcaaactg
ggatgactttttgtgtgagctcctaacttaaggactaagaaatacaaaagatcagtttcc
gtaaataaactggctcacaagtgtgcagtagttttaaactttctttttctttgcttcaag
GATTTTGACTCTTTCTTCTCTGCAAAAGAAGAGAATATTATTTATTCCTTCCTTGGTTTG
GCTCCTCCTCCAGACTCAAAG
gtaagtttgaacaaactccattggggttcaaaacaggtaatactaaatgaaggtagaaat
caccgcatccaagactgtttaatacatgatgatctctaaattaacattactttagtacac
ttcttattctgatgcagtcctatgcatagagagaatgcagtttttactaaaaaaagttcc

Exon  7 +      28469      28801   0   Internal    333    75        Good
tctgtttcttctctgtttgctttgctttcctttttatttttatgtaagttgttttcctca
gatgtttggtgatctttgactgtttgtatttaaaacaaagtactgagctggcagtggtgg
gtgcatgtctgtattcccagcaactaggaaggctgaggtgagaggattgcttgtgcctag
GGTTTCGAGGCCAGTCTTGGCAACATAACGAGGCTATGTGGTGGTGGTGGTGGAGGTGGT
AAGGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGATGGTAGTGCTGGTGGTGATAGT
GATGGTGGTAGTGGTAATGGTCATGGTGGTGATGGTGGTGGTGGAGTGGTAGAGGTGGTG
ATTGTGGTGGTGATGGTGGAGATGATGGTGGTGGTGATGGTGGTGGTGGTGACAGTGATG
GTGGTGATGGTGGTAGTGGTGGTGAGGTGGGTGATGGTGGTGGTGATGGTAGTGGTGGTG
ATGTTGGTGTTGGTGGTGGTGATGGTAGTGGAG
gtgggggtgatggaaagtgggagataaatctggctgccagtgttctagaagcaagtaggg
aagggaatggagggtctcccctttcagaatgtgaacttcttatatagaccccttgttttc
agtatggttgcctacttcagctggcctcatgcccaggaggtcatatttcctctagttcag

Exon  8 +      37764      37880   0     Single    117    74        Good
ggaaggtgatgcattctggcctgtagctgagcagagctgagcagtccgacatgtaacttc
attgagaaccagaccgcagagttcaaggaggccttccagctgtttgactgaatgggtgat
ggcaaggcccttacagccagtatggggacatgacgagggccttgggccagagccccacca
ATGCCGAGGTGCTCCAGGTCCTGGGGGAACCTCAGGAGTGATGAGATGAATGTGAAGGTG
CTGGACTTTGAGCACTTCCTGCCCATGCTGCAGACTGTGGCCAGGAACAAGGACTAG
ggtgcctagttttaggattatgtccgagtccaaggattatatggaaggtctttgggtgtt
tgacaaggaagagaagggcaccatcatgggcgctgaaatccggcaagtccttgtcatact
gggtgggaagatgacagaggcagaagtagagatgctggcggccgggcatgaggacagcaa

Exon  9 +      37900      38076   0     Single    177    63    Marginal
ccagtatggggacatgacgagggccttgggccagagccccaccaatgccgaggtgctcca
ggtcctgggggaacctcaggagtgatgagatgaatgtgaaggtgctggactttgagcact
tcctgcccatgctgcagactgtggccaggaacaaggactagggtgcctagttttaggatt
ATGTCCGAGTCCAAGGATTATATGGAAGGTCTTTGGGTGTTTGACAAGGAAGAGAAGGGC
ACCATCATGGGCGCTGAAATCCGGCAAGTCCTTGTCATACTGGGTGGGAAGATGACAGAG
GCAGAAGTAGAGATGCTGGCGGCCGGGCATGAGGACAGCAATGGTTGTCAACTCTGA
agagctcgtctgtgtggtgctgagtagctgggcacattcccagcatccccccagccctgt
cctttgccctgtgagacactgtgtatctagccccgaaggctttctggtcacagcaccctt
cccatcttgtctcttttggataatgcttgccatgagcattcaccaataaacttgttctct

Exon 10 +      49130      49222   0   Internal     93   100   Excellent
gcattttggagtttggagatcctatgctctagtcgctaagtgacctaatgagtgggcagt
ctatgtttgcttcatttatatactgtgtgtctaaataagaaagccacagcatatgtggcc
tgtttttttttttcttttttctgtttttgagctcatatcctgggtttcctttatgaccag
GGATCAGAGAAGGCTGAAGAAGGTGGAGAAACTGAGGCACAAAAAGAGGGCAGTGAAGAT
GTGGGCAACCTCCCTGAAGCCCAGGAGAAGAAT
gtgagttttcgctttttcacagcagtttgactggattctctgctgttcgagacttttaca
gggcttgtacaacttgactctgggcacaagcagtcagaaagagggcaaggagctgagagt
ttagccagggaggaagcaagtaatttctactgatgtgttaagcactggaatcctggtgca

Exon 11 +      53058      53185   1   Internal    128    58    Marginal
ctctgctatgaaacatgcatactcaatgcacacttgtaggcactcatacaattccattta
atggagaggaatatttacctaatgtttgacattgattaaaaaaatcaacagaaatggaaa
caaaaactattatcttctttaatgatatggacttcccctgaccacctcctcaacttccag
GGTTCTTAAAGACAAGATGCCAAGATGTAAATTCTGTCCTTGATAAAGGATTGAGGCAGG
AGGACTTGGGAGGTCAGGAGGGTGAACACCGAAAAGACCATGACTTCATGCCTAGGAAGA
TCTTACCT
gtaactttagaaaataggggacctcatggggcctggcctgataacccaggggagggtgag
gggctaaggaaccggcgcctcaggagtaaaggaggaaaacagaaagtcagctcagcttct
gggcattctctaagaaatgaactgcagactgggacatcatgagagctttagaaaatgctg

Exon 12 +      61001      61083   1   Terminal     83    74        Good
tgtggcatgtgtggtgtgtgtatttgtgtgttgtgtgtgtttgtttgtgtgttgtgtggt
ggggtgtgggaggctttgacctctagtccagcattttacagtctttttctcactgtatcc
ttggcccttatgcttcttaatactaatgtaagttttgttaaaataagacggaagaaatag
CCATGGAGGGTGCGGAAGGGGAAGCCGAGGAGGAGGAAGAAACTGCAGAAGGAGAAGAGC
CTGGAGAAGACGAAGATTCCTAG
gccttttcatgcttcatttcttccacttctccaggtagctacaggattctggggtggaaa
agctgctagttaccgtactgtatgctatctgcggcacattttgcttagtaacaggagaaa
gggaattccaattcagggctgtctgtctccttccaaagccctggtctgcacacctttctg

--------------------------------------------------------------------------------