--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (18788 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1156       1285   0    Initial    130    90   Excellent
gcacagtcacttcccaggtctcaccgctggtggactgaccgggatcctcgggggccggcc
cacaccctcaccagtaccgcacgggccgctgcctgtgcctgccccagggtctcgggcacg
ggcccccaggtgggctgcgtgggggtgtggccgcctctgactcgctgtgtccttgaaggc
ATGAAGACCAAGCACGCGCTGCGCCACCACATGAAGCTGCACAAGGGCATCAAGGAGTAC
GAGTGCAAGGAGTGCCACCGCAGGTTCGCGCAGAAGGTCAACATGCTCAAGCACTGCAAG
CGGCACACGG
gtgagtccgaggcccgggccgcgccagccacggcgctcactgtgtagggaagccaggtgg
gccgtgggagaagagagagccgccttgagacgattcctctttgtgattcccactgagtgc
cgggttccccaagagagcttcctggggccggggtgagcagctgcatatctcaaaaggtcc

Exon  2 +       6016       6155   1   Internal    140    93   Excellent
tccaagccacactttgctggccgaggctggagatgagcgttcattgtctgctgtcttctt
gcaattcaccttctccagaaggccctacagtgcctggaacgtgtcagggagaagacatgc
cctgatgtggacttacaacactcattaaacgtaggaagttatgtgcgcctttctctgcag
GGATTAAAGATTTCATGTGTGAATTGTGTGGGAAGACATTCAGCGAGAGGAACACCATGG
AGACCCACAAGCTCATCCACACAGGTGAGCGGCGCAGCCTGAAGGAGCCTTCGGGGCGCA
CGCGGCAGGCTGCCGGGGCT
gtctgagtgcctgctggggtggaaacgactattctattatctagacggttccagcacatt
tagtgttgtcttggcttcatggtggccccttggcctctgaaggtcaacccgccacagctt
tcaagtatcccttcttgaattttctcatattggttccgtgatgcagctgctgctggcagt

Exon  3 +       6534       6698   0   Internal    165   100   Excellent
gctctgtgctcatgtgtgctcggggaccagcaccggccctctcaggatgggcggggcgtg
acaggcttcttgcctcgtccagcaggccagggtcattgggatggctgcactagtgacctg
cgtgtctcttcctttccacgcgcatgtgtgtctgcgtgtgtgtgaaaagtgggcaagcag
TGGACGTGCTCCGTGTGCGACAAGAAGTACGTGACCGAGTACATGCTGCAGAAGCACGTT
CAGCTCACACACGACAAGGTGGAGGCGCAGAGCTGCCAGCTGTGCGGGACCAAGGTGTCC
ACCAGGGCCTCCATGAGCCGACACATGCGGCGCAAGCACCCCGAG
gtgagctggtggctgtgccccctccgtgccccgccagcgggccgcgcaccggacaccccc
atgctggcacatggcccacctccctctgcagacccccagtactggaggcaggccctgagt
cttaggtgcgtctgtgactggcactgcctgccacacaggaggcactgagtgagtggctgc

Exon  4 +       9738      10110   0   Internal    373    77        Good
taggattgatactattttatgactccaagctatggtttttctctttactttgaatgaatg
ttacattaaaaacaaaacacagaaagcaattttcacttttttcttatatcctaagaagag
tgaagctaatgcttctatggtggttctttgatggcgtcagctttcagactgtgtgactag
GATACTGATGATATTGATGTGATGGTGGTGGAGGTAGTGGTGGAGATGGTGGTGGTGATG
GTGATGGTGGTGATGGTGGTGGTGGTGGTGATAGTGGTGATAGGAATGGCAGTGGTGGTG
ATGCCACGTGGTGGTAGTGGTACTGATGATGGTGGTGACAGTGTTGGTGGTGATGAGGGT
AATGATAGTGATGGAGGGGGTGGTGATGGTGTTGTTAATGGTGATGGAGGTGGTTGTGTT
GGTGGTGATGGTGTTGGTAATGGTGATGGAGGTGGTTGTGTTGGTGGTGGTGGTGTTGGT
GTTGATGGTGATGATACTGATGATAGAGGTGGTAATGATGATGGTGGTGGTGGTGCTTAT
GGTGGTGATGGTG
gtgacggtagagagtgcgtccacagcagtctggttgcttttgctcagggtcctttgcgag
tgtcacagtatagatctgtgctcagtgtcaatgagagttacactggagtcttcaaagcca
ttgcaggatttatgttaacttaaaacacttacagaccagcctttgtttgccatcttttcc

Exon  5 +       9955      10123   0    Initial    169    87        Good
tggtggagatggtggtggtgatggtgatggtggtgatggtggtggtggtggtgatagtgg
tgataggaatggcagtggtggtgatgccacgtggtggtagtggtactgatgatggtggtg
acagtgttggtggtgatgagggtaatgatagtgatggagggggtggtgatggtgttgtta
ATGGTGATGGAGGTGGTTGTGTTGGTGGTGATGGTGTTGGTAATGGTGATGGAGGTGGTT
GTGTTGGTGGTGGTGGTGTTGGTGTTGATGGTGATGATACTGATGATAGAGGTGGTAATG
ATGATGGTGGTGGTGGTGCTTATGGTGGTGATGGTGGTGACGGTAGAGA
gtgcgtccacagcagtctggttgcttttgctcagggtcctttgcgagtgtcacagtatag
atctgtgctcagtgtcaatgagagttacactggagtcttcaaagccattgcaggatttat
gttaacttaaaacacttacagaccagcctttgtttgccatcttttccaggaaggggccca

Exon  6 +      11202      11321   0   Internal    120   100   Excellent
gggcttctggacacagagtttcaaagtcagagctgaacagaggagactgggaagtgcggg
ggatgcctgggagggaagggcaggagtggtggaggtggtcccaaggcgtgtgtggcttct
gggttcccacctgcatcagcagcaccctgacccccagctcatgccctgtgctcctcatag
GTGCTCGCGGTGAGGATCGATGACCTGGACCACCTCCCGGAGACCACCACCATCGACGCC
TCCTCCATTGGCATCGTCCAGGTGAGCAGCATGGGGCCCCAGGGGCTCAGAAACTTTGGG

gtaagtggacacctgcagaagggaccagaggggcttggacaggccgggagggagcagctc
tgggcaagcctgtggccaggttaccctgttttcttggcttctcttcccctcagaacctct
tagatcatctcctcgtttctgtagtttctgtgacctcagtttgttgaatactggtgtatc

Exon  7 +      12895      13104   0   Internal    210    84        Good
ttgccccgatccttagaaatacaagacccagctgtggtcactgtttcttgtggcagctcg
gtggcccacaagcgtccccactgattggagagtgtgtccagggcagtgctggggctgccc
tggccgctgcctgacgtgaccgactaacctggttctcggctgaaaccgatttttctgcag
CCTGAGCTGACTCTGGAGCAGGAGGATTTGGCCGAAGGGAAGCACGGGAAAGCTGCCAAG
CGAAGTCACAAGAGAAAGCAGAAGCCAGAAGAGGAGGCGGGTGCTCCGGTGCCCGAGGAC
GCCACCTTCAGCGAATACTCAGAGAAAGAGACGGAGTTCACAGGCAGTGTAGGCGACGAG
ACCAATTCCGCAGTACAGAGCATTCAGCAG
gtcagtttgctgctttatgttctgattaggtgccggtcactttccctaagcatgagagcc
ttacgtgtgtgtgactccatctctttttactatacacagtgtacatgtggacttcatgtg
gttgaaggcagcagacattctgtttttcacttaagcatgtttcatgtaagcatttctgag

Exon  8 +      14094      14576   0   Terminal    483    84        Good
tctgtttcttgtttttgtttctcgctggaatttttccagaacaaaattaactcggtttcc
tctttcaccaaagaatgtcgtgcttctttggtgtggtaacacagagcgcatcctggggag
gtccttgcgttccccattttgcaaaaatgaacggatttttgttgtgtgtgaatcttccag
GTAGTGGTGACCCTGGGTGACCCAAATGTGACCACACCATCGAGCTCAGTCGGCTTAACC
AACATCACCGTGACCCCCATCACCACTGCGGCCGCGACTCAGTTTACCAATCTCCAGCCG
GTGGCCGTGGGGCACCTTACCACCCCTGAACGCCAGTTACAGCTGGACAACTCAATCCTG
ACCGTGACCTTTGATACCGTCAGCGGCTCTGCCATGTTGCACAACCGCCAAAATGACGTC
CAGATCCACCCCCAGCCGGAAGCCTCGAACCCACAGTCTGTGGCCCATTTCATCAACCTG
ACGACCCTGGTCAACTCCATCACGCCCCTGGGGAGCCAGCTTAGTGACCAGCACCCGCTC
ACGTGGCGGGCAGTGCCCCAGACTGACGTCTTGCCACCCTCGCAGCCGCAGGCACCCCCA
CAGCAGGCGGCCCAGCCCCAGGTGCAGGCGGAGCAGCAGCAGCAGCAGATGTACAGCTAC
TGA
gctgcgttccgggagactcggggcaagaactgcagagggatgtttgggatttgtttagat
gtgtttgctggataccaaacaaacaaaaagtcatacattgcaatgtaaggttgacttagc
tttgcagagtatctccagatcccccgccagcaaccattacggtctgtcagcttaactcta

Exon  9 +      17106      17209   1   Internal    104    78        Good
aagcaattgctacaaatttgcatcaaagaaactagatagcaaaatacaacaaccatgtac
cacccaggcagaagagtcctcacctatacgcagttctgcatattgatcatcatgacagga
agtatttcgttttttaactgatcccaggtgcacagatgtattcataaaggaagacattag
ATCCAGCCATTGTGGCCACCAGGCTCTGTGGACCCATCTCAGTGGAGAATTCGTTTTGGA
CCCGTGGCTCCGTGCAGCTGTGGACTCGAGTGCCATCCACTGGT
gtgagtcttgcggggaggccacaggtacagctgctccccgtgaatcctggtctgtgggtt
gagaaggggctcgggcctctggaatgctctagcgtgtgacgtgttctcaggaaaacgttc
tgtgccaagtgccgcctcgctgtgtccggcatgggactgcgctggagggtccggcgtgga

--------------------------------------------------------------------------------