--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (80373 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (26 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1207       1236   0    Initial     30    46    Marginal
cggggtcgggcgcgctggaaccagagccggagccggatcccagccggagcccaagcgcag
cccgcaccccgcgcagcggctgagccgggagccagcgcagcctcggccccgcagctcaag
cctcgtccccgccgccgccgccgccgccgccgccgccgcccccggggcatggcctgtctg
ATGGCCGCTTTCTCGGTCGGCACCGCCATG
gtgagtgagcgcatccttcgtccgccgggaacggttttattttcaaggagagcaggaaac
acacaaagactcgcaagctcgacctgacacccctcccaggagcgcgtcctctgggcgctg
acccagggcaccctagagtggcgcccggctccgatcgctgcccctgcccctccgccaggg

Exon  2 +       7603       7846   0   Internal    244   100   Excellent
tgacggagatgacaaattcctctaggtgggcacatttctcctggggccaaaggtgctcct
gcagtggaagaagtgttgctattaataaccaatgaccctgagcctcatggtgaatctctt
catgttctttttcttgatgcagcttataacaggtcttgttgcttcctctggtttttctag
AATGCCAGCAGTTACTCTGCAGAGATGACGGAGCCCAAGTCGGTGTGTGTCTCGGTGGAT
GAGGTGGTGTCCAGCAACATGGAGGCCACTGAGACGGACCTGCTGAATGGACATCTGAAA
AAAGTAGATAATAACCTCACGGAAGCCCAGCGCTTCTCCTCCTTGCCTCGGAGGGCAGCT
GTGAACATTGAATTCAGGGACCTTTCCTATTCGGTTCCTGAAGGACCCTGGTGGAGGAAG
AAAG
gtagggagggcggctgctttgtgtatcaagctgggaggagcctctgaaggaggcaacagg
ttgtttgggcaaaatcggggtctggaggttgagaggctgagcttctcttcccaacgccgt
cactgctgtggtcaatttattctattgctttctgcctgaattttcctctcctataaaatg

Exon  3 +      11119      11159   1   Internal     41    52    Marginal
gtccgcctctgcgcctgctggtccaccaagtcggcctcttttgcccctcccatgcatggg
ttcctcctgctcctgcttttgtccctccaattgctggcggtggtctcagtccccagccat
gattaggttaggctgagaagtcagagcccagcctcactctgcatttctctcttctcacag
TGGCGGAGTTTGTATTTGGCATCATCTCTGTGCGACTCCAA
gtgtgacgttgggtcaggggctacttctctgactgctctcagtatattcattttgctgtc
tgtatcaagtccattgttttcaacttttaaaaattcagtttgatgcattgagctaattgt
aatgatcacgcggaggctggatgtcctggcattgctggggaggtgtctccgaaggtaaga

Exon  4 +      11880      12056   0     Single    177    42    Marginal
cccatggttcacagtagggcaaaggaaacaggagctcgggcgcagagctgattcactcaa
aggcagagccagggctaggacccagctattctgactccaagttccttcccattacaaaga
cactggaccactccggttgtttccaggaaagactttttctcacatgatttcccccaaaac
ATGGTGCTGCGATACAAACGCAACATACAACGCCCTAGCAAAGCTGAGCATTGTGACCAG
AATAACTTTATGAAGTCCTACGTAATTATTTTAAAGAAGGAGAACTTCACAATCCTTACA
AGAAAGGCGATGCGGGAAACAGTAGCGGCATTTTTAAGAAGAGATGCCAGGCACTGA
ttctgtaaaacttttgagcttgacagttactaagcgttgaatatggcattttaacaaaac
atcttgtattttcaattgtagttacattttcaccatatgactaatgatgtctttggaggg
aaaactagatcatataatagattcctagcagaaaacataattgtgagaggaactattctc

Exon  5 +      13097      13288   0   Terminal    192    52    Marginal
gactggaccaccaaggcacagctgtgcctagccccgtgttatgaaatggtgtggggttgc
cttggctgtaaactgatgtattttccttttaattggcctgcttggatgtcagcggccatt
ggccatttatagggatttcctgtccctctggagaggctccagcttccctcttctcaccag
GAAGGGGAGGCTGATGTGCATGGCGTGCTTTCTCTCCAACAGGTGAAGCGATTCTCAGAA
ATCAAATTTACCTCCCAAGATTACCTTGAGGCGAAGTTCAGGTTGAGAACAAATGTAGTC
ATATCTGGGGCTTTAGAGCGTTTTCTTTCCTATCTGCAGTCAGGCCGTGGCCTCCACATG
GTGACGCTCTGA
tggaatggaatgtcgcctccttctttgaaacccaaccctccaggctcatccttgccaaaa
accaggaaggggttaaatattccgggcagcgccaagtcagattatctgtattggtttgct
tctacgctataaaaatgcatttggacacctttctcaaattcggggttgctttctcttaat

Exon  6 +      16645      16747   0   Internal    103   100   Excellent
gccctggggttatcaggccacctggcctccacccagacgttccctcccagggcgggattc
atcctggcccgtggtgatgtgcaggctcccggaaggccgggctctgcccactaagtgtca
gctctaacgcaggctctccatactgagtaaaaaagcccgtcctttctctggctggtgcag
GTGCTGACTCTGCAGGCCTGTGGACGCAGGGTGACGTTCGCGCTCTTGCCCGAGCTCAAC
GCCCGGGAGAAAACAGCGCTGCCGGAGCCCCTCGCGCGCGCAG
gtgcgggcggggcgggtgcgcgctgccgcgcgtgtgcagcgcccgcccatccgccgccac
cgcccgcgccggggttactaccggtcaacgctcgctagtaacctccgcggcggagcggcg
gcgcggggagcggcgcgattggctgcgggcgccccgcgctgttgccaagcgcgaggaggc

Exon  7 +      18656      18858   1   Terminal    203    57    Marginal
gctttgctcaaccttttgggctcctgaccaaatgcaaagagacccaagggcttgcttttc
cttgcactcttgggttttcattgcctgcttgcttatttgattttgtgactgtggagctgg
catttctgtaagcccatatagaaattacagtttccaagcctaaacccactaagccaacag
GGGCACACAGGAAACCAGAGATGGTGGTGGATGAAAACCTTTGCAACAAGAAGGAAGGGT
ACATCTATGATAACTATGGTGTTACATTACTAAAAACAGTAAGGATGAGTGTCACTAACA
TGAGAATGTACTCTACACAAAAGTCTGGTGAAAAAGGGAGGAGCCCTTTCACTAAGTTTC
ATATTTATCAGCACTCACGTTAA
gaattacagcagaagctgcaggtttcctgtttctgaagacctgcgaatgagtttgtccag
aaaatggccgtgtcctgaatggtgtgagcaggaggccatccagccttgtgcctctaggcc
tcctccccttcagttgtcataaatgtgccatgtgcccctgcccaaacccagcagcctttc

Exon  8 +      21975      22218   0    Initial    244    51    Marginal
tcacgtggcctctgcagaatcagctagctgggcaaggggcctaagctccggaaggttccc
ctttggtcatttttgggtgtctggtgattgccaggcttccagtatctcaccactcaaatt
agagccccagaaagggagcatggtgtcatttcatcccctgggccgtggttgtgggagccc
ATGGTGCCTTCTGCAGGGCACTGGAGAACGCTGTGTGTGCTCATCTTGGGACAGGCAGGA
GAGGAGGGCAGGTGGCAGGATGAGGGCGGCTGTAGCCTGCAGGTCACACAGTGTTATGCC
AGACCACGGTGCCTGCCACGCTGGGTCTCCAACGGCCACACGAGGCACTGCTTCCATGTT
ATCAGTGAGGAAACTGTGGCCTGGAGACAGGTGGGCGATGAGTTCAAGTTCCTGCTGCCA
ACAG
gtggaccccaggaccaagcctagcccagttgacccctggctcctcctgtttgctctttga
gatcatatgaaacagccagtgactgcctagggccatggcccttttcagtgaacttgaaac
attaaaatgtttactgccttcacacttatggcttaaaaagttgtttggtttgtgttttct

Exon  9 +      27810      27966   0    Initial    157    67    Marginal
aaggctgagataagaccaggagaactggggctgtatttccttatctattcctgagatcca
tgctttctgaaaatcatctgcacatctaagcatcttggcacaactccgatgaggagggga
tggggcaccaggcagcagactctgatgaggaggggagggggcaccaggcagcagactctg
ATGAGGAGGAGACAGGGCACCAGGCAGCAGAAAGTGCTGACTCAGCAGCACAAGACCACA
TGGCCGGCTTCCCTTCTTCCTCGGAATGGCCTGGAATTCGATCAAGAACAGCAGCCCCAG
GAGCATCCTAGAGAGGTGGGGGCAGGCGGGGGACATG
gtgagggagggagtggcaactctgggcaggtggcaagagccagctgatgagtacagggag
ggagttcccttctccacccatccacactgacatctggggaactcatttaagctacagatg
ccagcttttggatttgcagaacggtgcagtgactgaattcgccatccaaacacttagaag

Exon 10 +      29316      29401   0    Initial     86    49    Marginal
acttttattatctgttataagcaaagtatttttgctcagtcttggggaggaaaaagtaaa
gatagcatgtccctcaatgagtttataattgatagggacacaaggagctctcactatcag
gcaggggttatctaagacagtgaataatgcccagagaagggttataggaattggaggagg
ATGAGAATCTCTGGAGAAATCACAGCCTTTGGAAAAGGCCACAAAGAGGGGCAGAACCCG
GGGGCACCCGGTGGAGAACTGAGCAG
gtgtggtgtttagaatttaggtaacgggagagtatggtgatgggcagtcttggaaatgga
ctttctgggaagcatttgggtggagatcttggactagactggtgactatggtgtagtggg
ttgatggtgaccctccaaaatggtacatacatgtcccaactctcagaacctgtaaatgtg

Exon 11 +      29771      29922   0    Initial    152    45    Marginal
agaaaaaggtcaatttgcagacagatgtgattaagttaaggatgtccagatggggccacc
ccggattaggatggattcaaaatccaaggacatgatcttacaagagaagaagagaagaaa
aagtcacagagatgcaggggagaagagacagagacatgtggaggagacagccccatgaag
ATGGAGGCAGCCGTTGGAGTAACACAGCCACAGCCCACAGACGCCTGGGGCCAGCAAGAG
CCTGGAGACGCAAGGAAGGACCCTCCCCTGGAGCCTCCGGAGGGAGTGTGGCATCGCGGA
CATCTCGATTTTGAACTTCTGCCCTCAGAACG
gtgagacggcacattttgtggcattttcttggggcagcctgaggtcactaatattataca
aaagaaaaggaagcaaagatggtcatgagagagcaacgttttgaaaaagaaaagtggtag
gaagcatagagaggaggataaagaagattaggtttctttctgcttatttgttaaacctgt

Exon 12 +      53002      53119   1   Internal    118   100   Excellent
aagacgtagaccagggaattcgaaagacatgaagttcatgttcttccctggaatgcagcc
ttttctatgatgcatgtcaaaggttgcctttggccttggtcatgtgtacttgaacatttg
catatttactgcattagagataaaatgaaatgaatatgaatatgatctgcttttttgcag
GATACAAGACCCTCCTGAAAGGAATTTCCGGGAAGTTCAATAGTGGTGAGTTGGTGGCCA
TTATGGGTCCTTCCGGGGCCGGGAAGTCCACGCTGATGAACATCCTGGCTGGATACAG
gtgagcagccctgcccagggcgcaaagttctctcccgggtgtcaggccagcagtgggaac
agtggagctccttccatcagccccatcacctggagcaggctgtggtctacagcagtagtc
caggggagagagtgacattgagaggctgcacttgccaagggccatatgatgggtggagag

Exon 13 +      55235      55367   2   Internal    133   100   Excellent
gatcgctgcagtgctagcgaggtccggtccctttctgcccctcggggtccccgtggccag
tggttcagctgggaagatgctgggaggcaagcccccgtctctggctcccctctcctgccc
cgggaggtggaggaggagcaggagcccggctgacggcttctcctgtccttggttctgcag
GGAGACGGGCATGAAGGGGGCCGTCCTCATCAACGGCCTGCCCCGGGACCTGCGCTGCTT
CCGGAAGGTGTCCTGCTACATCATGCAGGATGACATGCTGCTGCCGCATCTCACTGTGCA
GGAGGCCATGATG
gtgagctccgccctgccccgccccactccgcccctgccgcctgtccccagcgcccacatt
agacacagcactggccgagtgcccagctgcgagggacccaagggctctgccacgcggcct
gcacagggccagcaacctccctctagcggagttctaacaccagactcgctgttgggacag

Exon 14 +      59427      59534   0   Internal    108    68    Marginal
tgaagatggttagtcattcgtttaaaaataaccaccctccatccacctacacttgcaaga
agaaatttagttcttacatgttattaaccggcctcttaaaaaagaaaataaatacgtttc
caggatgatgaagactttctaatccctttagccattttttttttggcttcctaaacccag
GGAGCAGGGACAGATGCAGGTGGGCAGAGCCAGGGGGAGCAGCAGAAAGCCACACAGAGG
AAGGAGGCCACCAGCCTGGACTCACACACCCTCCACGGGAAACCCACT
gtcctcctctccactgcagctagtgctggtgggattttcagtgtgagatggaatttgggg
aaaccccccttctataagattatctttctctcctaacacccttaaaggctcacagtctgg
cagcagctgagagtggggtttgccgggttagtgccaatggctcgacatggccctttgtgt

Exon 15 +      63128      63162   1   Terminal     35    48    Marginal
gttcaggacagggctggagcccaggtcggctgaccctgtactgccacctgccctggcctg
tccagcagccgtgccccggttctttctgtcaccaaagctgcactttgtaccgactgtgca
taaataattcagaagctcagagtggaaattttcttcctcgtgagttcttcctcccttcag
ATGACTTCATCTCCCTAGAGGAGCCGCTGGAGTAG
ggtccgcttgctatggctcccaggggccggccaccacagggctgccctggcagggtgggg
acaatagctgggtgaatgctggagggagctccaggtgggctgtccccagggtagggaggc
agggatggcagtggctgacccagggcctgcttctgagatgatgctggggctgaaagcagc

Exon 16 +      64206      64351   0   Internal    146   100   Excellent
gcacctgccccacttggcactgggcagcctggagtgggttcgacttgcgtggcctccacg
tgggccaggcacggtgtgtccagcaggctgagggcggctggcaggtcttcctgcatgggc
catgggaggtggtgagctttggcgggcagctcccaatgtctctcgttctgttgcccccag
GTCAAGGAGATACTGACAGCGCTGGGCTTGCTGTCTTGCGCCAACACGCGGACCGGGAGC
CTGTCAGGTGGTCAGCGCAAGCGCCTGGCCATCGCGCTGGAGCTGGTGAACAACCCTCCA
GTCATGTTCTTCGATGAGCCCACCAG
gtaagtcaggagcatctgagctggtgtccaggggcaggaagaaccccctgtattcagcgg
ttcttccaggtgaccctgacatcctgatgtagcctcagagggggtgagttgagctcaccc
ggcggttcctccttccatctgggaccactgggcagaagagctgacttatgccccctctct

Exon 17 +      66492      66615   2   Internal    124   100   Excellent
ccctgccactgagcagcaaaacaaacagcaagagcagagcccggcctgggacggggcagc
tgcagctgcagcccctgatgccaagccctctgggacaggaactccctggacccccggaac
ctggggcagtggctagttcctgccgcccgcaggcgtctcacggtgcctcttgacttgcag
CGGCCTGGACAGCGCCTCCTGCTTCCAGGTGGTCTCGCTGATGAAAGGGCTCGCTCAAGG
GGGTCGCTCCATCATTTGCACCATCCACCAGCCCAGCGCCAAACTCTTCGAGCTGTTCGA
CCAG
gtacgcgggccccgggccctccccgccagattaccactgcactcaggtcagcctgaatga
caccaaaccctgggtacccactgccttctgttagctcgtggggcgtcttcatgacaccaa
accctgggtacccacagccttctgttagctcatggggcatcttcatgacaccaaaccctg

Exon 18 +      67812      68024   0   Terminal    213    63    Marginal
ttcccttcagatgttaatagggcccttgggggtgatgtaaagctctcaggagaggaagtg
gctgatcgctgggctgactgattgatcggttgattgattggttgattgattgattgaggg
ctccggttgccttccgaggaaggcagggcttgatccctttttctccttccttttttccag
CTTTACGTCCTGAGTCAAGGACAATGTGTGTACCGGGGAAAAGTCTGCAATCTTGTGCCA
TATTTGAGGGATTTGGGTCTGAACTGCCCAACCTACCACAACCCAGCAGATTTTGGTAAG
CGGAGTCCTGAGCAGCTCGGGGGACAGAAAGGGGATTTTCCTCCTCTGTGGGTCTCACTT
TTAGCTGACGCCCCCAACTCAGAAACCACTTGA
ctaccacaaatagctcaagtgtcatccagttataaaacgtttaaagaacaaaaaaattag
gtttcatttcctctagactctaggtaaaatcatctggccagcctgtctctgcctctctcc
tgtctccatgtcctaatcacctcctctcctgaggacagcagtcattggattcagggccca

Exon 19 +      69821      69933   1   Internal    113    54    Marginal
ggggggtttgagagccgcacgctggttgataaatgattttgacgtcatgccattagcacc
gccacgcagcatctatgtaatcgctttaaaacattcccacttgaataacgactttcgcat
ttgggtggttggggtgtccttcctggagcccgggctgacccccgtctgtgtctcctgcag
TCATGGAGGTTGCATCCGGCGAGTACGGTGATCAGAACAGTCGGCTGGTGAGAGCGGTTC
GGGAGGGCATGTGTGACTCAGACCACAAGAGAGACCTCGGGGGTGATGCCGAG
gtgaacccttttctttggcaccggccctctgaagaggtaaagcagacaaaacgattaaag
gggttgagaaaggtaatgcaaatcccgaagccccctgggggaggctgcacgtggcaccgt
gcactgctgcatgagagctctttccgagcaagaaggagccgtggctccggactggctttc

Exon 20 +      70143      70244   0   Internal    102    95   Excellent
tgaagaggtaaagcagacaaaacgattaaaggggttgagaaaggtaatgcaaatcccgaa
gccccctgggggaggctgcacgtggcaccgtgcactgctgcatgagagctctttccgagc
aagaaggagccgtggctccggactggctttcacccgctcccctcttgcgtgtgtcctcag
GACTCCTCGTCCATGGAAGGCTGCCACAGCTTCTCTGCCAGCTGCCTCACGCAGTTCTGC
ATCCTCTTCAAGAGGACCTTCCTCAGCATCATGAGGGACTCG
gtaaggctgcccgcatcttctcctgtagctggggaacccgtgggtcattttctcagactc
gtcctgacggaatgtgttcgttcattctcacattgctataaagaaattcatgaggccagg
catggtgactcatgtctgtaaccccagcactttgggaggccaaggcaggcagatcatttg

Exon 21 +      71982      72150   0   Internal    169   100   Excellent
gtgtgtatgtgagtcgctttagggtttggcttgtttctctggaggagaagacaggataaa
gtctaagacgtgctgtcacagagttcagggtcccatgcttccaaaggccgcatccgggtt
gttctctgagccgaggacggctttgcgaacgcactgggtaagatgcgggtctgtccccag
GTCCTGACACACCTGCGCATCACCTCGCACATTGGGATCGGCCTCCTCATTGGCCTGCTG
TACTTGGGGATCGGGAACGAAGCCAAGAAGGTCTTGAGCAACTCCGGCTTCCTCTTCTTC
TCCATGCTGTTCCTCATGTTCGCGGCCCTCATGCCTACTGTTCTGACAT
gtgagtgacagaccgctgaccccttcttccttattttcaattcctacccaagcatggggg
cctgaagtcacgccttgaccaacagatgagttttctaaacacaatgtttttgttttttta
aaatatcatcttctttgttgacagatgcaagttgtattgtatttgctgttagataagaaa

Exon 22 +      73024      73124   1   Internal    101   100   Excellent
ttatgcaaacgggtggcgtttttcaggctagcaaaacacatcctctgtttgttcaatctc
tcagtgccctaggccagagctgggttaccagccgctcagctcaagatcgcctgttgggat
gttaaacgggctcgctgcacatggtcactgacccttcttttttgcttttctatctcctag
TTCCCCTGGAGATGGGAGTCTTTCTTCGGGAACACCTGAACTACTGGTACAGCCTGAAGG
CCTACTACCTGGCCAAGACCATGGCAGACGTGCCCTTTCAG
gtgtgttagccaggggctggaatttgaaacgggggcaagagttctcctgtacacccttta
tatcgagtaagaggacctgccagggatgcagggtgacatggcccgacttcgggagctctg
gtgggagctgcggggaagggcctgacttcgggagctgtggcgggagctgtggggagtggg

Exon 23 +      73430      73588   0   Internal    159    95   Excellent
agctgcggggaagggcctgacttcgggagctgtggcgggagctgtggggagtggggaagg
acccgactttgggagctctggcgggagctgcggggaagggctggctgcccaggagctttg
ctgttggcctgctgtggtgggaagcggctgagcccgcggctgacgggtccttgtttccag
ATCATGTTCCCAGTGGCCTACTGCAGCATCGTGTACTGGATGACGTCGCAGCCGTCCGAC
GCCGTGCGCTTTGTGCTGTTTGCCGCGCTGGGCACCATGACCTCCCTGGTGGCACAGTCC
CTGGGCCTGCTGATCGGAGCCGCCTCCACGTCCCTGCAG
gtgccagcccaggaggcgctaagtgagggcatgacggctgggcttccctgagctaccttg
gcctgagctagggggctctgccaccccttcccctacttctgccctgaccctcctagatgg
ggtcgttcccacgggaagggcccgcattgtcgagggtcaggatcagctggcttccacagt

Exon 24 +      76474      76592   0   Internal    119    92   Excellent
tcagagatggtgaccccacacctcgggaacgctgcaccttctgccacattaagcatcatc
attaccctgcccagaaggtgccctggccctgcccgggggaagctggcgtgggcgagcctc
ctctgcaggaggccaggctgcaggttctgctacatctgtcctgtgtgcccccaactccag
GTGGCCACTTTCGTGGGCCCAGTGACAGCCATCCCGGTGCTCCTGTTCTCGGGGTTCTTC
GTCAGCTTCGACACCATCCCCACGTACCTACAGTGGATGTCCTACATCTCCTATGTCAG
gtagcgggcgtggggcacgcatggcgtggggaccgagggtgacgggggaagaaccgtctc
caacagcgtgaggggctcacaaaagccactctgggctgctggccaagagcagattacaca
tctgaggatccaggccttccatcttcctgctagttccacctcctcctaccctcaccaaca

Exon 25 +      78096      78324   2   Terminal    229   100   Excellent
tgcacgtgtttgtcttaagaaggtggtgggcggtgaggaagtattctggggaaggcggcc
ctttgggaagggaggatagccaagctgggaatcgcagggagggtgaacgacattgacctt
cagccaacggcgtggctggctgggagaacgtcctccctcatgcctggcctttcctcctag
GTATGGGTTCGAAGGGGTCATCCTCTCCATCTATGGCTTAGACCGGGAAGATCTGCACTG
TGACATCGACGAGACGTGCCACTTCCAGAAGTCGGAGGCCATCCTGCGGGAGCTGGACGT
GGAAAATGCCAAGCTGTACCTGGACTTCATCGTACTCGGGATTTTCTTCATCTCCCTCCG
CCTCATTGCCTATTTTGTCCTCAGGTACAAAATCCGGGCAGAGAGGTAA
aacacctgaatgccaggaaacaggaagattagacactgtggccgagggcacgtctagaat
cgaggaggcaagcctgtgcccgaccgacgacacagagactcttctgatccaacccctaga
accgcgttgggtttgtgggtgtctcgtgctcagccactctgcccagctgggttggatctt

Exon 26 +      80247      80305   0    Initial     59    44    Marginal
agatattaaagtgtaattttaagtgtgcttgttctatacaaatatggcattgccttccag
attaagtttttaaccagagtcaaacttagcctttataaaaagtcctcatttaatttcaaa
atagatcttcttgtaagacattgcacatagggaagacctacctaggaatagcctggtgaa
ATGCAGAATTGGAAAAAGGCAAAAGTCCTTGCTCATGACTCAGAACTACATCGAGTGAG
gtcagtgttgaaaacgcccattccctccaggtgagccttccccattgtggattagtgttg
tggcttcaa
--------------------------------------------------------------------------------