Gene ZFP64 Variant 1
DNA : 40.71 KbNT_011362
mRNA : 3263 bp NM_022088
CDS : 2046 bp NP_071371
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  396 bp
cgcgccccgcgcacccaccccgcaacggcagccgcacgtgggtctccccgcaaaccaccc
aggcgtcccgggagcagcgctgctgcacggccgcgctgggggcccaacgcctggggttgc
aggtgcaaaaggcgccccgagccggggaggccaatcgcgtccgcggagaacgcagagtgc
GGGCAGGGGCGCATCCCTCGCCACCCGCGGTCGCCCAGCACGCCGGGACGCGCGTGGCCA
TCCAGCTCCCCGGGGGCGTTGGGGGGCTCCGCGGGCCTGGGCCTCGGGATTCGCCCGCCG
CTTCCCCGGGGAGCCGCTGCTGCAAAGCCAGGTTGGGGCGCCGGGCCCGGCCAGCGCCCT
CTAGGCAGCGGAAGTGCAGCTTGCTTTACATCCGTCCTCCCCGCCTCGCAGAGTTGGGAG
AAGGCAGGGTGGGGGGTGTGGAAAAATAAAAGGAAAAGTCCTTGCACCATGTAGATCAGC
GTCCCCCACTTTGGCATCCCGGCCGGCCGGGGACCTCCCAGTCTGCGGCCATGAACGCGA
GCAGCGAGGGCGAGAGCTTCGCGGGCTCGGTGCAAA
gtaagtgcttttccgggagcagtgcgcgctccggggcccagtgcgcgctccggggcccgg
gcccaagcacgtctgcgacgcagccagcaggcccggggccccgaaatcggggtgacggct
cggagccgcgtctcggggaccgcggcgggcgcgctgtgcagggggcgccggagtgggctt
EXON 2  240 bp
taccttgctgctagggcacaattaggatgcagttcgcaggaagaggaaggtggagtggat
actgggccactacccagccatgtctgccaccatgccttttcttcctaccatgaatctggt
ctgcattacaattcaaagctgtttggaattaatccgttactttccctttgtcccatggag
TTCCAGGTGGCACAACGGTGCTGGTGGAGCTGACTCCCGACATCCATATCTGCGGCATCT
GCAAGCAGCAGTTTAACAACCTGGATGCCTTTGTAGCTCACAAGCAAAGTGGCTGCCAGC
TGACAGGCACATCCGCAGCAGCCCCCAGCACGGTCCAGTTTGTATCGGAGGAAACAGTGC
CTGCCACCCAGACTCAGACCACCACCAGAACCATCACCTCGGAGACCCAGACAATCACAG

gtacagctggagcatgggggagtcggccagaattggcctggctgtgtctcaaacacgtcc
atggaacttgttaaaaatatagattcccagagcccaccccctagggttgctgattcatta
tttttaacaagctccaccaggaagccagctgcccagccaggtttgggagctgctaggtta
EXON 3  162 bp
cccagcggatgctctctagtgtctcattagctagaactgggtcacatgatcactgtgaag
ccgcaagggaggctgggaaagcaaactagtacatgcattctctctacaaaggaaagtagg
cagacaccatagctagcgggcatttatattaagaaaattaataatcaccatatcttttag
TTTCAGCTCCAGAATTTGTTTTTGAACATGGCTATCAAACTTACCTGCCCACGGAAAGTA
ATGAAAACCAGACAGCCACTGTCATCTCTCTCCCTGCCAAGTCACGCACCAAAAAGCCCA
CAACACCACCTGCTCAGAAAAGGCTTAACTGTTGCTATCCAG
gtaaaggcagcattatgtcctacttgtgtagagggtgtgatatttaaccaggctccaggg
ctcctcctcatgagttcctgacaactgctcatggatgtgttccaaactacctggcataaa
aatcagagccccctggcatttacatcagcacatacaacctatctcccactgtctgtggtc
EXON 4  63 bp
gaaccacaaaatgacggtgtgtttttcccggtcatcacatatgaaggcacatgagatctc
tttttcccattaccgtggtgttaactcttgtcacttggttaaggatgtttctaccagttt
tctccatgctaaaagttactaagttttcctttgtaattaatctttcctttttttttttag
GTTGCCAATTCAAGACTGCTTATGGCATGAAGGACATGGAGCGGCATTTAAAAATTCACA
CGG
gtaagtagcatttctttagcgcatatgccctcaacacctgctctgtgctaggagatgggg
atccacataggtcagacgaatgataccactccaaacgtcactggctgttatgggaataca
agtccagattttaaaaaataaggtgccatttgtacacatgactttggcagaaaaatcttt
EXON 5  252 bp
gaagaaacttcccctctcccaagatgttagctctttgccaatcatccacccagtgtttta
gggtttttggaatattcttcggtggttgtatatgacttttttcgtaaggcagtgggaaat
aagccttttccttttttaatcttgtttcctgctgccatctgtgtgtgtatgtgtttgaag
GAGACAAACCCCATAAGTGTGAAGTCTGTGGCAAGTGCTTTAGCCGGAAAGACAAGCTGA
AAACTCACATGCGGTGCCACACGGGCGTGAAGCCCTACAAGTGTAAGACGTGTGACTACG
CCGCTGCCGACAGCAGCAGCCTCAACAAGCACCTGAGGATCCACTCGGACGAGCGGCCCT
TCAAATGCCAGATCTGCCCCTACGCCAGCCGCAACTCCAGCCAGCTCACTGTCCACCTGC
GATCCCACACGG
gtgagtcctgcctgttatttgctctctacgctcctcactttctatggcataaatcataag
caccttaaagcattcagccacaatgtaagaaatcgagttggaacctttgctcatcccgtt
gtttgcagttttgtttttttttgttgttgttgttttgtctcgctctgttgccctggctgg
EXON 6  2150 bp
tccggggaaagataaagacgccctgcccctcttcccccactgccaggggctgctagaagc
tgcagttaggaggtctgcacccacccaccttgtataagcgattttctggtgtgtgcttcg
gggggatccgctgtggttgttgcctgcctgttcttatcgaaactcaccttgtgttgacag
GGGACGCCCCCTTCCAGTGCTGGCTCTGTAGCGCCAAGTTCAAAATCAGCTCGGACTTGA
AAAGGCACATGCGGGTGCACTCGGGGGAGAAGCCTTTCAAGTGCGAGTTCTGCAATGTCC
GCTGCACCATGAAGGGGAACCTCAAGTCGCACATCCGTATCAAGCACAGCGGGAATAACT
TCAAGTGTCCTCATTGCGACTTCCTGGGTGACAGCAAAGCCACCCTCCGGAAGCACAGCC
GCGTGCACCAGTCGGAGCATCCTGAGAAGTGCTCGGAATGCAGCTACTCCTGCTCCAGCA
AGGCCGCCCTGCGCATCCACGAGCGTATCCACTGCACCGACCGCCCTTTCAAGTGCAACT
ACTGCAGCTTCGACACCAAACAGCCCAGCAACCTGAGCAAGCACATGAAGAAGTTCCATG
GGGACATGGTTAAGACTGAGGCTCTAGAGAGGAAGGACACCGGCAGGCAGAGCAGCCGGC
AGGTGGCCAAGCTGGATGCCAAGAAGAGTTTCCACTGCGATATATGCGATGCCTCCTTCA
TGCGGGAGGACTCGCTCCGCAGCCACAAGAGACAGCACAGTGAGTACAGTGAGAGTAAGA
ACTCGGACGTGACCGTTCTCCAGTTTCAGATCGACCCCAGCAAGCAGCCCGCCACGCCCC
TCACTGTGGGACACCTCCAGGTGCCCCTCCAGCCCAGCCAAGTGCCCCAGTTCAGCGAGG
GAAGAGTCAAAATCATCGTTGGGCATCAGGTGCCCCAGGCGAACACCATCGTCCAGGCTG
CCGCCGCTGCAGTGAACATCGTCCCGCCTGCCTTGGTGGCCCAGAACCCAGAGGAACTCC
CAGGGAACAGCCGGCTGCAGATCCTGCGCCAGGTCAGTCTGATCGCCCCCCCTCAGTCCT
CGCGGTGTCCGAGCGAGGCGGGCGCAATGACCCAGCCGGCTGTCCTGCTGACCACCCACG
AGCAGACGGACGGAGCCACTCTGCACCAGACTCTCATCCCCACGGCCTCAGGTGGCCCCC
AGGAAGGCTCTGGCAATCAAACTTTCATTACCAGTTCGGGTATTACTTGCACTGACTTTG
AAGGCCTAAACGCCTTGATTCAGGAGGGGACAGCAGAAGTGACAGTGGTGAGCGATGGAG
GCCAGAACATCGCAGTGGCCACCACAGCGCCACCGGTCTTCTCCTCCTCTTCCCAGCAAG
AACTACCCAAGCAGACCTACTCCATCATTCAAGGGGCAGCCCATCCAGCTTTGCTCTGTC
CCGCCGACTCCATTCCAGATTAGTGCTTAAAAAAACAAAAGGAGTGGGGGAAAGGAATTG
AGAAAAAGAAATCTTAAGTAGAATTCTCTAAAAGGTTTGCTCTTAATGTTTTCTTTGTTT
TGTTTTGTTTTTGAGACGGAGTCTCGCTCTGTTTCCCAGGCTGGAGTGCAGTGGCGCTAT
CTTGGCTCACTGCAACGTCCGCCTCCCAGGTTCAAGCGATTCTCATGCCTCAGCCCTCCG
AGTAGCTGGGACCACAGGTGTACGACATCATGACTGGCTAATTTTTGTATATTTAGTAGA
GACGGGGTTTCATCATGTTGAACTCCTGACCTCAAGTGATCTGCCCACCTCAGCCTCCCA
AAGTGCTGGGATTACAGGTGTGAGCCACCATGCCTGGCCGTGGTTTGCTCTTAATGTTTT
TAAGGATGGTTGTGAATCCCCCTGGCCCCATAATAAATTGTAATTTTATACTGCTTACTA
TAATTTTTTTAACACTGTAACAACTTTGAGACCACCTCTGAATCGTCGCATTATAACTGT
TGTAGAATCTTAAATGTTACCAAGATGATTCCAATGAGGGGTTGGAATTAAATGCATTAA
GTAGTGAATTCATGTGTTTGTTTCCAACTTGATTTTCCAACTCTAATAAAGGTTTCTGTC
CATCTTATTACATTTGTGTAGTAAATGGTACTTCCCAGCCTCTCTTTTGCCCCATTCTGG
AATACTCCCCAGAGTTTGGGGGTGTTCATGTTTTATACATGTAAGTCTGTTGGCATGAAG
GACCATTTTCTACATAATATGACATGGATACTTGACCCAAAAAAAAATGTTTAGTGCTAA
TGAGCAGAAAATGAATGGTTCCATAATAAATTGATATCTGATTAAAATAT
actgaatgttaatgattctttagagccaaggtgggatttgggaatgatggggcgtgagtc
attaatcaaaaacaaactgaagcagcaaaggtttttagtcctttcataaacgtcacacaa
tcatcttacctcctccacagtcacattaaatagatgtggtacctaaagtgataaagtgat