Gene TPD52L2 Variant 1
DNA : 26.24 KbNT_011333
mRNA : 2285 bp NM_003288
CDS : 621 bp NP_003279
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  95 bp
gcccgcagtttcggcctatcaggttgagtcgggtaaaccaggacgggccaagcggcactc
tcattggatatcactggtgggggcgggaagaaggcggagcacgtgcccgggcggaagtag
ccgtcgcatcgcggattacgaaacgccgcggagctgaggcagttccgctggctagtgtgt
ACGCGGCGAGCTTCTCCCGGCGCCGCCCGCTCGGCTCCCATAGCGCCCGCGACAGCGGTC
CGGACGCCGCCCGAACATGGACTCCGCCGGCCAAG
gtacctgccgggcccggccccttcgccgcagatgggcccaggctgcccgttgttctccgt
ctcccggggtcgcgtctgcgactctctgtcctctcggtctcggttcacccaccccgcggc
ccctcttcagctcccggggccactgacctcgaagcttatgatggtcgtggtgtgtttttt
EXON 2  146 bp
tgaggtgtggctgccctcgtctactgcccatgctgtcctcacagacctttcagagaagag
gtgttagtctccagggtctcacccactcccacctgtgcttttgtcctgctagagacctct
accgtatttacttggaactaacttatttgacactttgtggcctcattttgtctctggcag
ATATCAACCTGAATTCTCCTAACAAAGGTCTGCTGTCTGACTCCATGACGGATGTTCCTG
TCGACACAGGTGTGGCTGCCCGGACTCCTGCTGTTGAGGGTCTGACAGAGGCTGAGGAGG
AGGAGCTCAGGGCTGAGCTTACCAAG
gtgctgtggcttggctgtctgtcctggggtgaattggagttaaggccctcttggattagt
gagaggccagggtactggccacgctcgggaggaattgccctgggtggtcacctaccctgc
tctgtgttccgactgataacggggttctctttgtatgtgcccagctccatgcactggact
EXON 3  149 bp
aaaaaaaaaaaaaaaccaaaacccaaaaatcagatgtctgctgtagatgctgttattcct
aggacgagttaatgctttggtaagcggaaagttcttgtgtaactcatggcactgtgcatg
aggatgttagtcacttcctgcagtagtgatggctcatcatgtcaactgcatgctttgcag
GTGGAAGAGGAAATTGTCACTCTGCGCCAGGTCCTGGCAGCCAAGGAGAGGCACTGTGGA
GAGCTCAAGAGGAGGCTGGGCCTCTCCACCCTGGGGGAGCTGAAACAGAACCTGTCCAGG
AGCTGGCATGACGTGCAGGTCTCTAGCGC
gtaggtacctgccccaggcgcacccctgggggctgaagagaacgggcaccacacgtgccc
cggcatgtgggggggcgtcgtcatgcccagggacgagttgcagccgtggagttgagtggc
ctgtttggaaggatccagagagaggctctgagcccttggcccagcgactgtgccttgttt
EXON 4  60 bp
ggcggcctggggcctgcacagggcctggttgaggcagtggaccccatttttgggccgtct
gtggagttgatgttcctgccagctggtccctctctgtcttccctggaacttcacctgcag
tttgatgcctgagttaaaattgttcttctaaataattcactgtagactttctgtttttag
CTATGTGAAAACTTCTGAGAAACTTGGAGAGTGGAATGAGAAAGTGACCCAGTCAGACCT

gtgagtgcctgtatcatcagcacctcctccttcctcctctccgcctcctgacactcagtc
ggggaagggggctgtgcacacttggcacaaagcttgttttggtatttgctggctattttt
tcttcctataacttttcttctctcaggtaaactatcctttaaacttttgtggaacaggga
EXON 5  102 bp
ctctgggggccgaggggctctgggcctgcaccccctctgtagacacctggcgagtgtcca
ccccttggcccagctcctttcctcagttttcctcgggcgtgctcccagtgctttgtttgc
ttggctgtgggtggtgacccgcccatgctgtctggttgatttaactggtgtgtcttccag
CTACAAGAAGACTCAGGAAACTCTTTCACAGGCAGGACAGAAGACTTCAGCTGCCCTGTC
CACAGTGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATGAG
gtgagacgcaaccctgactctgctgccctgagacctggccaggagtgaggtgaggtgttg
gaggtgctacaggaagcctgcctggagatcagggctcagatgcactggctcagggatgtg
gccatccatcatggccccgaccagtctgtgtgcagacccttgcctgggaggttcgtccat
EXON 6  49 bp
ctcacttttgacctggggagtctccggaatgacctggctgtctcacagttttgccatgag
atcttgggatgttgttagggaccctttggaggctggccctaaccctgaggcccttccgag
ttaggagagcagcacaaccctctcctcttgacaccgacactcttccctctctctttaaag
GAACTCTGCGACCTTCAAGTCGTTTGAGGACCGAGTTGGGACCATAAAG
gtaattgtacctggactgtttgatggtcttggcaaggtgtgacctgttacagcaacttgt
ttattattagtcatttagttatggtagactcacatacagttgtgggaagtaatgcagaga
ggttccttgtgccttttacacagttctctcctgtgacgacatcttggaaaatcctgtagt
EXON 7  1684 bp
tggcatcgttctctggagacctgttggggctggtgcccgtccgtgatttgctccctgtcc
ctgctgagcagtgttcgtgttacataagcttttgtagagcattgagcatgggcctgggat
ctgccttgtgttgtgtgctctgtctcaggtttttctgtcttcatcttttctctcctgtag
TCTAAGGTTGTGGGTGACAGAGAGAACGGCAGTGACAACCTCCCTTCCTCAGCGGGGAGT
GGTGACAAGCCCCTGTCGGATCCCGCACCTTTCTAAGCCTGTGGTTGCTTCACCCGCTGC
AGAGCACACGCAACCCAGCCTCAGCATCACAGCCGCAGCTCTGTTCAGCGGAGCAGCCAG
CCAGGGCGGATGAGCAGAGCCGGCCCTGAGGACAGTCCTGCCCATCCACGCGGAGATGTG
GCTGCCGCGTTTGCATGAATTTGAAGAACACAGGCTTGTACACAGATGTTTTACACTCAC
GTTTGTAGATGAAACAGATCACTGTGCTGTCCTTCCTAGGGGTGCAGGAAGTGGACAGGG
CGGAGGGTTTGAAAGAATATTGAGCCAAAGCCCAGGCTCCCTTTGGGAATCATGTTAGCC
CATCAGAATGTTGAAGGATTGAAGAGTTCTAAGCATAAAATAAGTGGCATTTTCTGACTT
CTTCCTCCTCCTCCTTCCCTGACTCACAGAAGGAATGCAATCACCCAGCAAGTCCTACCT
GTTACGCAATTTTTTATCTCAAAATGCCGAACGAGAAAACTGTCCATTTTCTGAGACCCC
CAGAAAGGAAACTGACCCTCAGCAGCTGCCTGATTGTTACGCGAATCTAGCTTTAACGGA
AGCAAATTCATTATTTTTTAAATGCAGTGGACTTTTCAAAAAGTTTAAATTAGGCAAAGC
AGCTTTAGCCTCATAGAATATTATTTCTTTGGACTCAAGCTGAAATACAAGCCTTACATT
GCCTTATGCTTTATTTCTTTCTAATTTTTATATGTATATAGATGAGGGTTCCTTAATGGT
TGTGAGCATTGTGTGGAATTTTACACCTGGCCTGCGTGGCAGCCTCTTCCAGTTGAGGTG
TTTTATGTCACGCACACTCCATCCCAGTGTACAAAACCTGCTTCTCTTCTCAACCGTGGC
AGCTCCCGCTGGCTCCTATGCCCTGCCCTAAAGGGCTCTTGAGCCTCTGGGAATGGGAGG
GGCCAAGAGAAGGAAAACCCTGTCTTTAGCACCCTTTAAAAGAACTGTGCCCCCCTTCTC
AGTGCTGCCTTTGCATGGGCCTGGCCCGGCTCACATTCGTCAGTGACTCCAACCCTCCTG
CTTGCTGTACTTGGGATGAAACGACCCCACAGGTCAGGTGGAGGGTGGGGCGTGGGCATC
AGCCAGGATTGCCGTTACAGTCTTTTTCTCAGGAGCTACAAAGATCTCTTCCTGTTACTA
AATAGTCGCACCCCAGCAGCCTCTCTCGCACACCGGGGCCCTGCATGTCAGATGGCGTGG
TCTGCAGGGGGAGCTCTGTGCCTTAGTGGCTCTTGGCAGGACACTGAGGGCCTGCCTGTG
GTGTGCCCGGCTCTGCCACTCCCGGGAGGGGAAGGGCTGCTCAGCTCAAGGTGTCCTGTT
CGGTAGAGCAAGTGTCCTCTGACAGCCGTGTCCCCGGACAGTTCAGACACCCTTGGGGAT
GGCACTCCACACACGACAGAGATGCAGGGGCCAGGGAAGCCCAGCGCTCGGTGCCCTTCG
TCCAGGGTTAAAATCGGCCTGTGGGGTGTGGTGAGAAGGCAGGTTGTGCGGGTGTTGACC
GATGTATCTTTTCCTTAAAGTTATTATAATAATGGGTAATTTGTCAATAAAGCATTCCTT
TGGG
ggaaagtccgcctcggcttgtgtgatgtatcgttcgggaccatgataagagtggtaaatg
aactggcacacggtacctgccctaatgagtccgcacccttgggagaggcaggcaggggac
agtgctaaagacaaagggcaggtcctcaatgctgggacaaggggagccagctgtgagggg