Gene TGM2 Variant 1
DNA : 36.08 KbNT_011362
mRNA : 3160 bp NM_004613
CDS : 2064 bp NP_004604
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  56 bp
ctcgggctccggtcccctgggtgagccccagcgctggcggcgtgggcccgggactgggca
atgggtggcctcccaggtcgccgccttcccgcggggccccgcccccggcccgccccaaag
cgggctataagttagcgccgctctccgcctcggcagtgccagccgccagtggtcgcactt
GGAGGGTCTCGCCGCCAGTGGAAGGAGCCACCGCCCCCGCCCGACCATGGCCGAGG
gtgagtatcagagtcaccgcagccgccactcaggggccccggggcattgggggtcaggac
ccggtgggagctgaatccctaagtcctgatttggagagcaacaggcagaccgggctgggt
gaggaggcgtctcaatgctgcttggagcctcagtttccccatccacactgcataaccatt
EXON 2  180 bp
agattgggccccacctagcccccgtgtgaccagggctggggagacaggtcagtcgaaaca
atggctgtgctttgtggggagtaagagggcacaaggcccccatgtctagggagggcaggt
gcatcactggaggtctgaaggatgcccccgaggctcatgcgtctccttctgtttccatag
AGCTGGTCTTAGAGAGGTGTGATCTGGAGCTGGAGACCAATGGCCGAGACCACCACACGG
CCGACCTGTGCCGGGAGAAGCTGGTGGTGCGACGGGGCCAGCCCTTCTGGCTGACCCTGC
ACTTTGAGGGCCGCAACTACGAGGCCAGTGTAGACAGTCTCACCTTCAGTGTCGTGACCG

gtgagtacctgcaaccccactccaccaccaccaccaccaccaccacttcctctccacccc
gacatgccccagaaccctgacagagaacaggacaaataactttaccttctttgttccctg
ggagattgccacctgtcatcagccccattttagagatgagggaactgaggcccggaaagg
EXON 3  243 bp
ctgagcccccctttacagatgaggaaactgaggctcagggagacaaacttcttgccaaac
ttatttcagtggttagtggcagaactaggcctggagcccaagctgggggaccccacgtag
gtgccctgccctgccagccctgctacccctagctcacggctactgcttctccctccacag
GCCCAGCCCCTAGCCAGGAGGCCGGGACCAAGGCCCGTTTTCCACTAAGAGATGCTGTGG
AGGAGGGTGACTGGACAGCCACCGTGGTGGACCAGCAAGACTGCACCCTCTCGCTGCAGC
TCACCACCCCGGCCAACGCCCCCATCGGCCTGTATCGCCTCAGCCTGGAGGCCTCCACTG
GCTACCAGGGATCCAGCTTTGTGCTGGGCCACTTCATTTTGCTCTTCAACGCCTGGTGCC
CAG
gtgagccacacgccatccactcacagcgttggggtgggcagggctggatccgcccatgga
ggaggctactggaggtgagaagaacaggggataagagacacacatcaaagtggactgagt
gaggcccactgtgctccagcctcacaaaaccctcaagacatgagtactcctgttatccct
EXON 4  119 bp
ataacaccttatctcattgacgtgggattattcattaatggttactttttctaattaaaa
gaaggatggatccctgagacgctggcttggcctagggaattggcacccttgactccagat
ttgcagggaccctgggcctccgcagacccagagctgaggtccctttcttcctgcctgcag
CGGATGCTGTGTACCTGGACTCGGAAGAGGAGCGGCAGGAGTATGTCCTCACCCAGCAGG
GCTTTATCTACCAGGGCTCGGCCAAGTTCATCAAGAACATACCTTGGAATTTTGGGCAG
gtaagggccacaccctgtctctcccaaccatctcaggcccttctgtgtgcccggccctgt
gtctgggggcagccaaagctgcacaggtgggagtgagtcacagagtcacccacttcatgc
tgtcagggatgcaaaggccctgaaacagctgaaggttcagagagggccaaggctgccctg
EXON 5  129 bp
ctccattccctcctgtgccaagagaagctgccaccagagagatttggtagactcggccgg
agtgtcccagtctgctgtgtgggacagagtgggaaacagctgctggaggcttcaacgcag
gcttcctggaggaggtgccttcccagctccctctttctcctcttgtttcctctgacacag
TTTGAAGATGGGATCCTAGACATCTGCCTGATCCTTCTAGATGTCAACCCCAAGTTCCTG
AAGAACGCCGGCCGTGACTGCTCCCGCCGCAGCAGCCCCGTCTACGTGGGCCGGGTGGTG
AGTGGCATG
gtgagtgagtggcatggcccatccaggggcggggcctacagggggctcccgcaggcctct
ccctcgcagtggagacacaggctaggcgcggtgggggacccgggagatgggtaagtcttg
gggaaaagaccttatattggaaagataagatttgcacagatgagggtgatgctatggggt
EXON 6  178 bp
ccagcccccaccatctgccgcacaccagtctgtcacacgatggcccctttgcacctgctc
tttcctcaccctggagctcccctccccagctttcaccccctgctgtactcaggctcaccc
aggcggcacagccgacaccccatcccaggctcagtccccgtgctgccccactggttgcag
GTCAACTGCAACGATGACCAGGGTGTGCTGCTGGGACGCTGGGACAACAACTACGGGGAC
GGCGTCAGCCCCATGTCCTGGATCGGCAGCGTGGACATCCTGCGGCGCTGGAAGAACCAC
GGCTGCCAGCGCGTCAAGTATGGCCAGTGCTGGGTCTTCGCCGCCGTGGCCTGCACAG
gtgagctgcacgctgggatgtgggtcatgagccctgggagggggcacgaagagcactgga
gtaggaatcaggacatccctgccctggtcctgccccctgccaccaacactctcaatgcgc
tatgtggcctagagcctgtgaccaccctctccggtcctttatccaatagccatccctcca
EXON 7  136 bp
gaatggacatggggtgaccagagaggtgggcgccattgtcccggcaggaagggctggctc
atgttctcagcacttggacagcaggtacagtgttccctggaatgcagatgggcaggtgga
ggcccagagcagggcggatgtctccaggacctcaccccgctttccactcctctccaacag
TGCTGAGGTGCCTGGGCATCCCTACCCGCGTCGTGACCAACTACAACTCGGCCCATGACC
AGAACAGCAACCTTCTCATCGAGTACTTCCGCAATGAGTTTGGGGAGATCCAGGGTGACA
AGAGCGAGATGATCTG
gtgaggtgggggccagggtgggatcggagcccagtagggagggccccatggagaggaaac
cttggagggcttcttggaggaggtcacatttgaattgggccttaaaagttcagcagtatt
tgagcaggcttggggaaggcctagagggaaagtcaaccacatacatgatggggcctcagg
EXON 8  104 bp
gagggtgctgtgagatgggcccccgtggggggaagaacaaggcagtggggagacaccctg
ggctcagtttgggacgaggcgagcttgcatctggggacatgaatgcatggtctgcccgtg
ggaggtggcgatgaatgttgctcatgttctgcttcattcccgcccccctatccccctcag
GAACTTCCACTGCTGGGTGGAGTCGTGGATGACCAGGCCGGACCTGCAGCCGGGGTACGA
GGGCTGGCAGGCCCTGGACCCAACGCCCCAGGAGAAGAGCGAAG
gtgcgtgggcgggcactgtcgcgtcaaacagatggggaagacgaggcttggagagttaaa
gtgactcagctggagggcggcagaactaggagctcacccggagaccactgatgggtccac
agaagggtgggggacctcacttacatcttaataacacacttcttgataaatctcaaaaat
EXON 9  243 bp
ctccagagcccctattctgaacccttgccctgtggtgccctcctggaagtggagtccttc
cgtcagagggccgcgtggtcttgaggtttttggctacatgtgattgaattgtggagcgtt
ttagaggacaccacccaaccttcacccaggcccatcccttcccctttctacctctgccag
GGACGTACTGCTGTGGCCCAGTTCCAGTTCGTGCCATCAAGGAGGGCGACCTGAGCACCA
AGTACGATGCGCCCTTTGTCTTTGCGGAGGTCAATGCCGACGTGGTAGACTGGATCCAGC
AGGACGATGGGTCTGTGCACAAATCCATCAACCGTTCCCTGATCGTTGGGCTGAAGATCA
GCACTAAGAGCGTGGGCCGAGACGAGCGGGAGGATATCACCCACACCTACAAATACCCAG
AGG
gtatgtgccctcagagtctttaatgcagccttgaagataagcatccagttttcccagccc
ggcaggctcgtgtatgtgtgtgcgtgtgttttaattggtagcctacgtacagcaatggcc
ccgtaggctatactccatcttcagcaatgccttagaaacaggagcaaacatgttgaggga
EXON 10  273 bp
gagttcactagtggaaaattaatgaaatgctgtgtccttctggcccagaaatgtagagaa
ggggctccttcatggctgccctgagtcatcaggcctctgcgaagacagctcgccctgttg
cagcccccttcctgtgatctattccagctgtgattgaggctctcttctcaacccctacag
GGTCCTCAGAGGAGAGGGAGGCCTTCACAAGGGCGAACCACCTGAACAAACTGGCCGAGA
AGGAGGAGACAGGGATGGCCATGCGGATCCGTGTGGGCCAGAGCATGAACATGGGCAGTG
ACTTTGACGTCTTTGCCCACATCACCAACAACACCGCTGAGGAGTACGTCTGCCGCCTCC
TGCTCTGTGCCCGCACCGTCAGCTACAATGGGATCTTGGGGCCCGAGTGTGGCACCAAGT
ACCTGCTCAACCTCAACCTGGAGCCTTTCTCTG
gtaaagccctgtgttcctggagcatttgttgaccgccaactgacaacatgctaggtagtg
acctaaccacttagcatgtgtgatttcaccccacagacacttacatggcgctgactctgg
ggcaggccctgtcctaagcactttataaatatcaacccacttaattcttattgcaagagt
EXON 11  161 bp
tctccagctcctcgctgggaaccctggagccacagtggggagttcagggatccgcccagc
cattcccccgctgtgtgaccccaagcacattccttcccctctctgtgcctcttggagttg
caagagagttgggaggggtgattctgcatcatgagcaccctcctttctccccttctgcag
AGAAGAGCGTTCCTCTTTGCATCCTCTATGAGAAATACCGTGACTGCCTTACGGAGTCCA
ACCTCATCAAGGTGCGGGCCCTCCTCGTGGAGCCAGTTATCAACAGCTACCTGCTGGCTG
AGAGGGACCTCTACCTGGAGAATCCAGAAATCAAGATCCGG
gtaagggcaggctgggcaaggggcagggtcccagggcagctcagcgctggggagagggca
gatccctacccccaccccacacacctgcatccctgcaagctccagacctttggtgcctta
gcgatcctcaaatcctagcctcatcgaagaaaagcatcatgaagcctagagaattgggga
EXON 12  137 bp
tagcacaatcggtgttttcccgatgaagaaactgaggcacagaggtggggggaggggggg
tgatcgtggcagacctgggtacagctttgttcagcaaatattgggccaaattgcagtgaa
tgcagacagcccagcctggatcccacctgcccttgacatctgccccatgccctcttccag
ATCCTTGGGGAGCCCAAGCAGAAACGCAAGCTGGTGGCTGAGGTGTCCCTGCAGAACCCG
CTCCCTGTGGCCCTGGAAGGCTGCACCTTCACTGTGGAGGGGGCCGGCCTGACTGAGGAG
CAGAAGACGGTGGAGAT
gtaagtgctggctgctctagctttggggcctgggggaagcgggcagatgccggtgggggt
agagactgtccttaggtaccaagccctggctgaaaatcccctcctctcatctcccacaca
gctgtgcccactcccagacaccctggggctagagttcccaccgtcacattctctgtcaat
EXON 13  1201 bp
cacaggcactgttcactctaggagggcagattgtccaggccccgcagagggccgagaatg
aggcccattcatggacacgctgtgctgatcctcggaggtcacgtgacttcctggctggac
cccagcatgcgggagccaggccttgggcccctttcctcaccaccccctctctccctgcag
CCCAGACCCCGTGGAGGCAGGGGAGGAAGTTAAGGTGAGAATGGACCTGCTGCCGCTCCA
CATGGGCCTCCACAAGCTGGTGGTGAACTTCGAGAGCGACAAGCTGAAGGCTGTGAAGGG
CTTCCGGAATGTCATCATTGGCCCCGCCTAAGGGACCCCTGCTCCCAGCCTGCTGAGAGC
CCCCACCTTGATCCCAATCCTTATCCCAAGCTAGTGAGCAAAATATGCCCCTTCTTGGGC
CCCAGACCCCAGGGCAGGGTGGGCAGCCTATGGGGGCTCTCGGAAATGGAATGTGCCCCT
GGCCCATCTCAGCCTCCTGAGCCTGTGGGTCCCCACTCACCCCCTTTGCTGTGAGGAATG
CTCTGTGCCAGAAACAGTGGGAGCCCTGACCTTGGCTGACTGGGGCTGGGGTGAGAGAGG
AAAGACCTACATTCCCTCTCCTGCCCAGATGCCCTTTGGAAAGCCATTGACCACCCACCA
TATTGTTTGATCTACTTCATAGCTCCTTGGAGCAGGCAAAAAAGGGACAGCATGCCCCTT
GGCTGGATCAGGGAATCCAGCTCCCTAGACTGCATCCCGTACCTCTTCCCATGACTGCAC
CCAGCTCCAGGGGCCCTTGGGACAGCCAGAGCTGGGTGGGGACAGTGATAGGCCCAAGGT
CCCCTCCACATCCCAGCAGCCCAAGCTTAATAGCCCTCCCCCTCAACCTCACCATTGTGA
AGCACCTACTATGTGCTGGGTGCCTCCCACACTTGCTGGGGCTCACGGGGCCTCCAACCC
ATTTAATCACCATGGGAAACTGTTGTGGGCGCTGCTTCCAGGATAAGGAGACTGAGGCTT
AGAGAGAGGAGGCAGCCCCCTCCACACCAGTGGCCTCGTGGTTATTAGCAAGGCTGGGTA
ATGTGAAGGCCCAAGAGCAGAGTCTGGGCCTCTGACTCTGAGTCCACTGCTCCATTTATA
ACCCCAGCCTGACCTGAGACTGTCGGAGAGGCTGTCTGGGGCCTTTATCAAAAAAAGACT
CAGCCAAGACAAGGAGGTAGAGAGGGGACTGGGGGACTGGGAGTCAGAGCCCTGGCTGGG
TTCAGGTCCCACGTCTGGCCAGGCACTGCCTTCTCCTCTCTGGGCCTTTGTTTCCTTGTT
GGTCAGAGGAGTGATTGAACCAGCTCATCTCCAAGGATCCTCTCCACTCCATGTTTGCAA
T
gcttttatatggcccagccttgtaaataaccacaaggtccactccctgctccacgaagcc
ttaagccataggcccaggatatttctgagagtgaaaccatgactgtgaccaccttctgtc
cccagccctgtcctggttccttcctatgcccaggtaccacccttcagaccccagttctag