Gene SYCP2 Variant 1
DNA : 58.47 KbNT_011362
mRNA : 4964 bp NM_014258
CDS : 4593 bp NP_055073
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  37 bp
gtaatttaataaacaggtgtttagtgaggaagttaatgttgcctttggtataaataacaa
atgcatatttatgtgtgtaagatatttaaactgataaacacatgaaacagattgtgagat
acagaaaatatatgttttcttttataggtgtttattttgtcttgcttttttttttttttt
AAATGAAGTCAAAATGCCAATAAGACCAGATCTCCAG
gtatgtagtcctagaccaaaagtaagtattttcattctgaaaatcactttttgtttactt
ataggtattcagtgctatgtttttagcaatgataaagcttacatgtttttatgaaatggt
caagaatagtttaaataaagtgtcctttcatgtattcattagatgtttgcaaaagctatg
EXON 2  144 bp
aatttctaattcagttgttccaaatttaatagtggccatatttttaaaaaatacgtgaat
taatattttatgagttcatttgagagttttcatgtgaaaacggttctcaaattactagat
tgcataaggtaattaattttggttttgatacagtatgtgccattaaatatatttctctag
CAGTTGGAAAAATGCATTGATGATGCTTTAAGAAAAAATGATTTCAAACCTTTGAAAACA
CTTTTGCAAATTGATATTTGTGAAGATGTGAAGATTAAATGCAGCAAACAGTTTTTCCAC
AAGGTGGACAACCTTATATGCAGG
gtaaatattcatttttgctgaatgattgttacaattattagatagaactctagttttaga
aggaagtactccattagaaaaaaatgaataggcttgggcaagctcagtcataattatata
aataaatgcttatttcaccatttgcttattattgtttgtttgtttgaggaatctcaacac
EXON 3  131 bp
tggctttgggcaggtcacattcttaaaccacattttcatctgttgcaatatagagatgat
taaaatgaccatctttcaggatttgtgaagattaaaatatatgtgtaacactccttgtac
aatgtctatttcatactgttttgtgtttacagaaattttaatgtataccttttatttcag
GAACTTAATAAAGAGGATATCCACAATGTTTCAGCCATTTTGGTTTCTGTTGGAAGATGT
GGCAAAAATATCAGTGTATTGGGGCAAGCTGGACTTCTAACGATGATAAAACAAGGACTA
ATACAAAAGAT
aagtatagaatatgtaacatattcatgtgaatgaaatattataaaagatatgctttctag
taagaaattatccaaattgttgaaaataaatttaggaactttatgtacaattttgggaat
aaaacatttctataacttgtgatatatgttacaaatataaagatcacaaactgtacaaag
EXON 4  103 bp
aaagatagttaaaaaaaaacaaggaagatctttaaaaacatgaatttattttgatacaac
actaaaattttaattttgatgtgtctttattcctaggtttactgtttatgcaaagataga
taagtacattcttaaaattattaaaatggaactctaataagttcattcctttttttacat
GGTTGCCTGGTTTGAAAAATCCAAGGACATTATTCAGAGTCAAGGAAATTCAAAAGATGA
AGCTGTTCTAAATATGATAGAAGACTTAGTTGATCTTCTGCTG
gtaaaaatcacattgattacactgatatttataaagcatgtgtttatttaaaaaacaatt
tgtgttctctgtgccctgagcctaaaagtcactaacagattggttggtgacttggttgga
ttggtctgttcagattgtataaagcatttattctggtaaatataattaaatggttagtta
EXON 5  25 bp
cagattgtataaagcatttattctggtaaatataattaaatggttagttaataaaaagta
attatgctctgagttaaaatgtaatctgtcatttcaataccatttgtaatggtttataat
attgtaatggtttgtaatatatagtaacttgtaaattaaatattattcactttttttcag
GTCATACATGATGTCAGTGATGAAG
gtataataaacacttattttctattggaacaataaattttactgttagagttttagtata
attttacaattcccattgtgttgtcctagtattaagaactcattatctgattcaaggatc
aacaaacttttactgtaaagggccagataataaatattttagactttgtagtccaagaga
EXON 6  86 bp
cccaggctggtctcaaactcctgggctcaagcagtctacctatctgggccttccaaagtg
ctaggattataggcctgagttaccatgcctggcccctttccactaactcttataagaaaa
gactgacagttaagaggatttgaaatgaacatttatcaataatttaacacttttattcag
GTAAAAAACAAGTAGTGGAAAGTTTCGTACCTCGCATTTGTTCCCTGGTTATTGACTCAA
GAGTGAATATTTGTATTCAGCAAGAG
gtaaagtcatttatttgtgttttaaaaactaaaaatgagaacgtgaagaaaatcaatagc
aattaaattgacaatttatttcatgtaggacaaaattacttagcttggagtatatttcta
tcataatctattgcctgacatatttccgaaatacttactgaaaatttataaccatatggg
EXON 7  86 bp
gccaccatgcctggcctattttatactttatatattctttcctccatcctactccattcc
cataataaaactcagtgattaagaaaaaattaggcttctaagtttatgtgcctagaatat
ttctcttaatagtgtttcactgaatgtaaagttaatgcattatctttttttcttttctag
ATTATAAAAAAAATGAATGCTATGCTTGACAAAATGCCTCAAGATGCCCGGAAAATACTC
TCTAACCAAGAAATGTTAATTCTCAT
gtaataatctgtacttatatggtttttattcttaaaatccataagaatgttttataagac
agacaactatgagtttgcattaataatgaaactgataaactgttgcagctttttaatata
atttagtgtatgcatataatttctgcaaaagtcgatgatattagccaattgtaaattttt
EXON 8  35 bp
atgaaactgataaactgttgcagctttttaatataatttagtgtatgcatataatttctg
caaaagtcgatgatattagccaattgtaaatttttgtgaagtttcttttcctcctaaaca
tgtggacttcctatttaattgatactggtctattttgtaatctgttattttaattcacag
GAGTAGTATGGGAGAAAGGATTTTAGATGCTGGAG
gtaagtatgtcttttccaaatctaaaattattccatatttatgaatagcagatagtatct
ttttaatttaaatattagcatagcaatgtgagactgagggaattataaacattatgtaca
attaagcaatttttaataaatatacatgaaatttgtctgggacaaaaataatttatgaca
EXON 9  143 bp
tgttaattcctcaaatgatgagatatttctaatccatatgaagaaaatattaatagatta
atcaattacattaatatattcttatttctcttgcttattctaataccttgtaaaatatat
ggtcttttataaacttaattttcataattgtaaatcaaacattaactatttttttaatag
ATTATGACTTACAGGTAGGCATTGTAGAAGCTTTGTGTAGAATGACCACAGAAAAACAAA
GACAAGAACTGGCACATCAGTGGTTTTCAATGGATTTTATTGCTAAGGCATTTAAAAGAA
TTAAGGACTCTGAATTTGAAACA
gtaagttgtataacaataacagaaattcgtgaatttttaaaaattattatgatttttaaa
agtatttctctttaaaattaggattgcaggatatttctcaaccttgtaaatggcatgctt
ggagacaaaagaaggtaaacttaatgcaagatacaaccatttactgtcaaataaatagag
EXON 10  53 bp
accacagaaaaacaaagacaagaactggcacatcagtggttttcaatggattttattgct
aaggcatttaaaagaattaaggactctgaatttgaaacagtaagttgtataacaataaca
gaaattcgtgaatttttaaaaattattatgatttttaaaagtatttctctttaaaattag
GATTGCAGGATATTTCTCAACCTTGTAAATGGCATGCTTGGAGACAAAAGAAG
gtaaacttaatgcaagatacaaccatttactgtcaaataaatagagctcaagagtgagca
cccagtgttgcatctttatacatttaactttattcttgttctctacactatgttggagtg
tagaatgtgcatagataatttaaaacaataacatgattttagcaaattactacaccagta
EXON 11  46 bp
ctacataaatgtccactaaacatgtattttgaaaagtattaaagagggaaatatgatttt
atttcaattattatgaccactgcctgatttccttttgattctaggcatgatttctattac
tggacaagattatgctgtgaaagcttatttatttttttcttaaactactttttatttcag
GGTCTTTACATTTCCTTGTTTATCAGCATTTCTTGATAAATATGAG
gtaaaattttaatttaacacattattttagttattgcatgaattttgatagtcaagtgaa
ttatgagttaaaaatgaataagaacactaaaaatagttgtaattagatcatgaatgtagc
tggtctagtattctgtatctgacagtgaaaccaggagaagttttatggaacagcatattc
EXON 12  96 bp
tattaaagtagcatttcatttgattgtttttaaatttatctaaatattatacttgtctgt
tctttctcttctctctccttctagctttgttttcttgctttagccatgaatataacatca
taattgtctgttatttctaaaatcattgtatattccagttttgtatgtttattttattag
CTGCAAATACCATCAGATGAAAAACTTGAGGAATTTTGGATTGATTTTAATCTTGGGAGT
CAGACTCTCTCATTCTACATTGCTGGAGATAATGAT
gtaagtttaatttggttggtattattctttatgtatatgcatatataagatttttactta
ctttaagaatgtggatttctttatatgttctagccagtctttacctagattttaatatta
gctctagtagtttgattagcatagcaacctaccaagctaattataaatgaaaactacttc
EXON 13  61 bp
attaaatataacatgtgtaatatgtagttaattggtggagcaagaaaggtgttatataaa
ctagttacttagtgactagcaaaaagaattcatagttcctgtaacttgaaatttgatgtt
taaagaaactgtaaatcagaaataaattatttatggccaaaacctgcttttaaatttaag
GATCATCAATGGGAAGCAGTTACTGTGCCAGAGGAAAAAGTACAAATATACAGCATTGAA
G
gtattaaacttgtttttttctaataattttcttaattcttaccatatggaacaaatgtta
catcctttctgggttaacaaaacagactaatgaaagcaaaatcaatattttcagaggttc
acattcagaaattcatcaaacaccttgatcccatgtttccctactaatctcccagctcta
EXON 14  149 bp
taaattgacttgattgatttacataggtaagtagtgccagaattgattaatttaaacact
gttcaatattgagaatttgaattttgattcaattaatctgctacatccatgtcttattta
tagtatacttgcagagtagtatcatagaaacgtaaactaatcagtgttgtttctatacag
TGAGAGAATCAAAGAAGCTACTGACAATAATTCTGAAAAATACAGTAAAAATTAGCAAAA
GAGAAGGGAAAGAATTGCTTTTGTATTTTGACGCATCACTAGAAATCACTAATGTAACTC
AAAAAATTTTTGGTGCAACTAAACATAGG
gtaagtctttaaacttaataaatatttactattttcataattctggaaacagtttggcgt
tataagttttattgcgttttttcctttctagaattcttaaaatgtagattttagttcttt
aaatttgtactgttgaagagtcatcagcttgttagtcatatctattgagatacccattac
EXON 15  75 bp
aaaggggagtaattgaagtgttctgagaaggtattcatatatgcaaagtaataatttggg
atatttggcaattttggaagaaaacaggaaataattacattaaatggaaataaaatgaca
tatgaaaaagtggaaagaaaatgaagaaaatgtcatcactgtgaattgatttaattttag
GAATCTATCAGAAAACAAGGTATTTCAGTTGCCAAAACGTCGCTGCATATACTTTTTGAC
GCAAGTGGATCACAG
gtatgtctcagacttacttgatttttatcactgggctaagtttaaccataactaatggaa
cagtaataaaggtgttgttggagggtgaatatatagaaaacaaatggtctcaatataaac
agtaccccaataaaatgtatatgatgtttaaacatgttattaatgataattttagtgtaa
EXON 16  147 bp
gagtttgaaaaaatggatactttttattggatcactttgtaaaaattataacagcacatg
gatagaaaagggaaataattgaatatgtgagatgagtaggagcttaagacatccagtgat
tgttgattactttctgtggtttgcagttttaaatactttttttttcatattctccaacag
ATTCTAGTGCCAGAAAGTCAAATCTCACCAGTCGGAGAAGAGCTCGTTAGTTTAAAGGAA
AAATCAAAGTCCCCAAAGGAATTTGCTAAACCTTCAAAATATATCAAAAACAGTGACAAA
GGGAATAGAAATAATAGTCAGCTTGAG
gtaaagatggtgtcaaaatactggcttataaaactaccattgatcaaatcactgttatat
atgagtactgaaagaagcatctagaatttatatattattggccttgatcaatcacatttc
agagtgtttctcctacctttgacaaatgcaaacaaaagatagtgtgtgtcttagcaaatt
EXON 17  100 bp
aacatgaagatgaacctttcatatcagcctaaaacatggaaatttatgaatattgtgttg
tttatttaaaaaacatatatctttggcatgtatcaaggcaaaatgttataagtaaaattg
taggatatttaatttcaaaaagactgtgtttacagtggttgtttttcatcgtggtttcag
AAAACTACTCCTAGCAAAAGAAAAATGTCTGAAGCATCAATGATTGTTTCTGGTGCAGAT
AGATACACTATGAGAAGTCCAGTGCTTTTCAGCAACACAT
gtaagttttatagttttaaaagatttctaacaattattttaaaggaggcattttttaatt
taaggcaattctgaacataatttacataaaggataagtttggtgtataaaaattgataaa
atatgaaccacaaatgtcttctaatgggaagaaaagtataatgctaacatatgaacagaa
EXON 18  161 bp
gcaaatttttccttcacttattatcttggtagatggcatctatattcacttaattatcta
agccagaaacctgggaaccatctaagaatgttcgtttcttacctttctcattggaaaagt
acctcaataatagcaataggtaaaaaaagaaaaatctgcaatccttgtcctcctttttag
CAATACCACCACGAAGAAGAAGAATTAAACCACCACTGCAAATGACGAGCTCTGCAGAGA
AACCTAGTGTTTCTCAAACATCAGAAAATAGAGTGGATAATGCTGCATCACTGAAATCTA
GATCATCAGAAGGAAGACATAGAAGAGATAATATAGACAAA
gtaactttaccttgaaagtattttaaaaatattttttcaagtaattgtggaaatatgtat
tgagctaactccttttgcaagctgcaagtgtctcattttgtttaaagcattacctttttt
cccctaaatatttattgcccttgaaagtagggtccttctggcatatgactcatttactgt
EXON 19  70 bp
tgtgtttcaggatagggaatattcaaaaacgggcataacgtttatgaaatatataaaaat
agtatccaacttttcatatcaaggcagatttgttttaaaagactcaaaccttaatactgt
aacatttaggttttcatataacatcttaagtttacgttaacctgtttcctgtgtttacag
CATATCAAAACTGCTAAGTGTGTAGAAAACACAGAAAATAAGAATGTTGAATTCCCAAAC
CAAAATTTTA
gtaagtaccttgtggtttaatttagtcatttttttaagaaaatgtatatacttctccctg
tattaccatttaaccccactggctttcattgatttgaaaaagatttacaaagaatttgtt
tgactttgtgcaaggaatttttgaggttacaaggaaatataccacctttgttccccagaa
EXON 20  58 bp
ggttacaaggaaatataccacctttgttccccagaagtttgggtttaagagagaggatgc
aaaatcgatcaatccgttcatcccaatatgtgaacctttatagatttctatactaacctc
cctatccccctgccaactgcatgaaaaaaatgaaaatattataatatttgttttatttag
GTGAACTCCAGGATGTTATACCAGATTCACAGGCAGCGGAAAAAAGAGATCATACTAT
gtaagtatgagaaaaccatcaaatcatttagtctatactaatgctgttttcagtgaatgt
aacagatttggaggaaaaggactgtatatgattagaattagtattaatcatctctcaagt
gttatgacagcacaatggggaattatgtatatggttttttccccatgtggtccaatataa
EXON 21  134 bp
gtagaaattaattaatgtgtagaaatataaatatacagtagaactgtaagataagataaa
tttccacataattttcacataagtaatcgctttcagtaaacgttgactacattaaaaatc
aaggtcttaaagtcacaggctaatgttttgtaacattaagcaaattaatttattttctag
ATTACCTGGTGTTTTAGACAACATCTGTGGAAATAAAATACACAGCAAATGGGCATGTTG
GACACCTGTAACAAACATTGAACTATGTAATAACCAAAGAGCAAGTACTTCGTCAGGAGA
CACATTGAATCAAG
gtgaaacttagttttatctatatgtaatagttcagtgttaatttcctcaaatgtctaaca
agtattaaaacaaatttaacaaattttacatatgtcaacttattaatttaaaaagaatta
atttctcattttccccaatagatattgttataaataaaaaacttactaaacaaaaatcat
EXON 22  437 bp
aaagagcaagtacttcgtcaggagacacattgaatcaaggtgaaacttagttttatctat
atgtaatagttcagtgttaatttcctcaaatgtctaacaagtattaaaacaaatttaaca
aattttacatatgtcaacttattaatttaaaaagaattaatttctcattttccccaatag
ATATTGTTATAAATAAAAAACTTACTAAACAAAAATCATCCTCTTCAATATCTGATCATA
ATTCTGAAGGAACAGGAAAAGTGAAATATAAGAAAGAACAAACCGACCATATCAAAATAG
ATAAAGCAGAAGTAGAAGTTTGCAAGAAACACAATCAGCAACAAAATCATCCTAAATATT
CAGGGCAGAAAAATACTGAAAATGCCAAGCAGAGTGATTGGCCTGTTGAATCTGAAACTA
CTTTTAAATCGGTTCTCCTAAATAAGACAATTGAAGAATCGCTGATATATAGGAAGAAAT
ACATATTGTCAAAAGATGTGAATACTGCTACTTGCGATAAAAATCCATCTGCTAGCAAAA
ATGTGCAAAGTCATAGAAAAGCAGAGAAAGAATTGACTTCTGAGCTTAATTCCTGGGATT
CGAAACAAAAAAAAATG
gtgagctttcaatgtgttttgatttctgcatatccataagatgcctacttgataacataa
gaaagaaagaaacttgattaattgctacacatttaacatgtgtaataccttgtttaattc
agtgcccagactctcagaattcctcactcacctctcccttgtcgtagctctgatagaaca
EXON 23  128 bp
aaaaaaaattatcttattttaatgcctaacaaagctcaaacttactaaacagttgactct
ctttatttctctccgcaggtataaatagaaccagatttatcttaaaagtttttttcagcc
tttatttttcctttaaagattaactggtagagtttaaaagtaacttacaatttttttcag
AGAGAAAAGTCAAAAGGGAAAGAATTTACCAATGTAGCAGAATCCTTGATAAGCCAAATC
AATAAAAGATACAAAACAAAAGATGACATCAAGTCTACAAGAAAATTAAAGGAGTCTTTG
ATTAACAG
gtatgttcttaaatttcagacatgaatatttttctgacagatacaactatattacacaat
tttaaaaaggttaattttaaacataggttcagataatgtaacttttcagtagaaaacaca
tggttacttaatacttttataaatagtaggtgtttaaattacacaagaagggaactaaat
EXON 24  37 bp
ctattataagtgctgtttactgtgagtgaagtagcaaaactatcagactattactgttac
attttggttatttttaacattgaatataaatttagtgacaaacatggtttatcttaaaat
gacttttatgatattgatactgatttgctttttcaattttgacaaaatctttttttacag
TGGTTTTTCAAACAAACCTGTTGTACAACTCAGTAAG
gtaggtgttatttacttaacttcaccaaatctatagtcaaactcaatatttgaccataaa
cactaaaatagcatagtggtaaaatggaatttgatacgatgttttcagaatattgctaaa
tgaatgataaccactgacaggtttaatagcaagtactcaaaatagccctccaaccttctg
EXON 25  71 bp
cagtgtatgaggcccacatcctcactagcatctgttattgcctgtctttttggtacaagc
cattttaactgaggtgagatgacatctcattttttgatttgcatttctgattagtgctgt
tgagcattttttcatatacctgttagccatttaatgatttttttataaccctcttttcag
GAAAAAGTTCAGAAAAAAAGCTACAGAAAACTGAAGACTACCTTTGTTAATGTTACTTCT
GAATGCCCAGT
gtaagtattttttgtaatatttttcattttcttcatatttgaagagactacacatattta
agtggagctaatattgctcttcattttcacaggaatgatgtttacaattttaatttgaat
ggagctgatgaccctatcataaaacttggagtaagctaaaataccaagatactttgtatt
EXON 26  58 bp
tataaccctcttttcaggaaaaagttcagaaaaaaagctacagaaaactgaagactacct
ttgttaatgttacttctgaatgcccagtgtaagtattttttgtaatatttttcattttct
tcatatttgaagagactacacatatttaagtggagctaatattgctcttcattttcacag
GAATGATGTTTACAATTTTAATTTGAATGGAGCTGATGACCCTATCATAAAACTTGGA
gtaagctaaaataccaagatactttgtatttactcagaagttacattgcatttaccatgc
agttattacatagaatgtttttaatgtgcatcctcatatgctttaaaatttttaagaaat
atataataatattttggataaccagcctacgtatatttaggtggctttttttttttttaa
EXON 27  56 bp
aaaaaactattctatttttagtgtattgtattttcttttcaaatacaaatattgtagtaa
agttaattttatgtcaaatcttatgattttgtgaagcaaaactagattttatgtttattc
cttttaatcttttttattttgacactgacacctctttttttttgtttatttacaatatag
ATCCAAGAGTTTCAAGCTACAGCTAAAGAAGCTTGTGCGGATAGGTCAATTAGATT
gtaggtatttttattagattaaaatattctgatctttttttttctcttaaatatctcctc
ccagtcttagagttttttaacaaatgagaagagtgaataaaaatgctagtcattattact
ctcattatgattctgttacttcaacatttactctttaaattaatatgcaaattatcactt
EXON 28  58 bp
ttaatccaatatagttattttataactgaggtcagagaggataagtggcttggccagaat
aatatagctaattagtgaaaaagttaagactgaaaactcaggtctaattgtccattgtgt
attaccttaagaaaacaagtatgaagggtattttttaattaatacatatttttgtttaag
GGTAGGTCCAAGGAATCATGATGAACTTAAATCTTCTGTCAAAACAAAAGATAAAAAA
gtaagttataatatctcaatatgtctattagaagtagtatttctcttaatttttaatgtt
aaagattatcaaaaacaagaaaacaaaaacattttgattgttttatttatgcaactatcc
accttcctattatgaattttcttatggtctttcagctatttgtaatcatctaataaaaga
EXON 29  169 bp
gtgactttcttggataggttattaatgccatcctaaattaggatgttaagaaatgacaag
ttagttttcctgttttgggttttgtttttttttgttgttgttgttgttttggtttaactt
accttgcatgacataatgagatgtagtatttcttcatgcatttcaaacttttttttatag
ATTATAACAAATCATCAAAAGAAAAATCTGTTTAGTGATACTGAAACAGAGTACAGATGT
GATGACAGCAAGACTGATATTAGCTGGCTAAGAGAACCGAAATCAAAACCACAGCTAATA
GACTATAGCAGAAATAAAAATGTGAAGAATCATAAAAGTGGAAAATCAA
gtaagaaattatcttttggataaatgttgcaaatgattttgcagtttatttcaattattg
aaaatgctttatataagcttattgtatttagactgttcattactacatactttcatggat
aggacaaaacactagtttttatgttttttgttttattttagtaatacggttatatttatt
EXON 30  38 bp
gggctggtatcctggtggcctgaggccacatggaggttcacttattaaatgctaacacat
gctttaaaaacttactactttttattattttaatttaaatatgctgaaatgatgttctaa
taaatttaatgcctattcttatttactgtgaaaatttaaccttatttttctgaattacag
GATCATCCTTGGAAAAGGGACAGCCAAGCTCTAAAATG
gtaagccaagaagtttgtgttcaaacatccctttaaaattattttttcttgccatataaa
aataattcatcatctcataattttatccttgttatcagttatgtgttttatgtacctctt
ccttcttttgcacactttctcctgtttctttttaaatcatactggcctttgactccattt
EXON 31  171 bp
atggtaaagatgataactggaatgggaagataaaatccattaatttaaagtatgttaatc
aagaatcattcttacaaatattttatgtaaaacttgtcacagtgccaattttatagcaaa
ttgcttgtatttcttgtacctcaaatattgatctaatattcaggaatttttctcctaaag
ACACCCAGTAAAAATATCACAAAAAAGATGGACAAGACAATTCCGGAAGGAAGAATCAGA
CTTCCACGAAAAGCAACCAAAACAAAAAAAAACTATAAAGATCTCTCAAATTCAGAATCA
GAGTGTGAACAAGAATTTTCACATTCATTTAAAGAGAACATACCAGTAAAG
gtaaatagatacagttcagattaatttctaaaagcctcttaaaatactaaatatatattt
ttgtaaaaaatgtcaaatttatcctgttacttcttaagagttaacttcttttatgacaaa
acttaaataataattctagaaatttgcccttaggcaatataatgctaaattttgtaataa
EXON 32  199 bp
gaatttgtcttatggcttctagtatattagaaagtctttcactactcatgtctaggtcct
tgttatgcctgtatgtggtaatatacaacatttaataaatatttgaatataatttgtttt
atgtgtccaagtgtaaatatttgtacttgagtataatttgaaagttattgatacatttag
GAGGAGAATATCCATTCCAGAATGAAAACGGTAAAGCTACCAAAGAAACAACAGAAAGTC
TTCTGTGCTGAAACAGAAAAGGAACTATCAAAACAATGGAAAAACTCATCTCTACTAAAA
GATGCTATACGAGATAATTGCCTTGACTTATCTCCCAGATCTTTATCTGGCAGTCCATCA
TCTATAGAAGTAACGAGAT
gtcagtataactttgttttttctttacttgaatattcaatagttttctataactctaatt
atgggaaaatacaattttaagactaattttgaggggtatttataattatagtagttaaaa
cttcattgttaagctaattaatgctagtaacttgacttttgataacatgggaacaatgct
EXON 33  206 bp
cagtcttacaaatattttaaatataacttggtcttaatatttttaaagctatcctttttt
atagctaagatttgaagatctgacaaattcttagaatttaaattaatcgtgctatttcta
aagcagacatcaatgataacgcttgccatctattttcttttttattttgatgcaatatag
GTATAGAGAAAATAACAGAAAAGGATTTTACTCAGGATTATGACTGCATAACAAAATCTA
TATCACCTTATCCAAAAACTTCATCACTTGAATCCTTAAATAGTAACAGTGGAGTTGGAG
GTACAATAAAGTCACCCAAAAACAATGAGAAAAACTTCCTGTGTGCAAGTGAAAGTTGTT
CACCAATTCCACGACCACTGTTTTTG
gtgagaatgtatatatatttttctctttatcagatatatctgaaggtagtaagttatttt
ccctatcatcttaatcagatacacattgcttgtctatttaaggttttgggtttggtctag
ggtcttgggggagagggacataatgacaagagagagatacttgccagtcttgatgaacct
EXON 34  186 bp
aataatccacttgcctaaggattttttatttttagttatgaattggaattgaatttttgc
agtgaattagtagttttgcagttttgctttaatgtttcttatgttcaactctttttgaag
tggggggctttgaacaattttgtaacttcttattgggtttttgtatgtcttcattcatag
CCCAGACATACTCCAACTAAGAGTAATACTATTGTAAATAGAAAAAAAATAAGTTCTCTG
GTACTTACACAAGAAACACAAAACAGTAACAGCTATTCAGATGTAAGCAGTTATAGTTCA
GAAGAACGGTTTATGGAAATTGAATCTCCACATATCAATGAAAATTATATACAAAGCAAA
AGAGAG
gtaagtgtgggactataacttataaattttccttacactaagatggttcttataagactc
agattactgacctttagtggtaattataatattttaatgcttttcaactgttattacctg
aaaatctgatgtttaaagtatatagaatggcttgatcatagaaaaatattttttgataga
EXON 35  91 bp
caacttagaatcaaggttaacacatggtaaatattagagatgaaaaggaagggatagaaa
caatctgagaaagaattgacagcatttaaaattattggtttttgggtttgagaaaggtga
taaaatgtgaattgaaatatatttacggaatttttttctaatttctaatacgtattttag
GAAAGTCATTTAGCATCTTCATTATCCAAGTCTAGTGAAGGAAGAGAGAAAACGTGGTTT
GACATGCCCTGTGATGCTACTCATGTATCAG
gtttgtagtcatagtcttgctttttaaaaaatgattactgaaatgctacgtgacatttca
actaaaggaattatgtattttaagtcataccgttattcaacttaatgtaaaaagaaaata
aactaggtagaattgaatgcataattacctaaaacataataaaaatacttagtggaaaca
EXON 36  156 bp
ataccgttattcaacttaatgtaaaaagaaaataaactaggtagaattgaatgcataatt
acctaaaacataataaaaatacttagtggaaacaaagcctttttaaaataaaagcaagaa
aatatgaggtatttttaatgaaaattgcagcgcttttaactttctttaactgttcctaag
GCCCCACCCAACATCTTAGTCGCAAAAGAATATATATAGAAGATAATCTAAGTAATTCCA
ATGAAGTAGAAATGGAAGAGAAAGGAGAAAGGAGAGCAAACTTGCTTCCCAAAAAACTGT
GTAAAATTGAAGATGCAGATCATCATATCCACAAAA
gtaggtagatcagtagcctgtatcaaaatgcagttatttggagggtggttcttatatttt
gaatgagtctatttacaaaacaaatttgtaaagacaactttggatatgtccaagatggat
gatgctttattgcaaagttcacatttatatgaataattgttgtagtaagggtcttagatg
EXON 37  137 bp
tcagaataatctgatttttaaattaaaaaaaacataaggaactcttctgcctttgatttc
ataatccttaggttacacatagattcggaaaataagatagattttgttcttagcctaatt
acaaggctaaatttagagtaatgcatattttaacttcagcagattgttttcattttttag
TGTCTGAAAGTGTATCTTCATTATCAACAAATGACTTTTCTATTCCTTGGGAGACCTGGC
AAAATGAATTTGCAGGGATAGAGATGACTTATGAGACTTACGAGAGGCTCAATTCAGAAT
TTAAGAGAAGGAATAAT
gtgagttattctttaaattatgatttatacccaataatataataatatgccacactttct
actagaccattggcttgtttgatcctttggcaacaaaatatccattcatgaaaccaactt
tccttatatgtgaataattggaataaaatctgtatattacccgtattctttcttttgcta
EXON 38  95 bp
agttcactcagagcagtgtctattaacacttcagtttaaataactgagtttttaattttt
cacttttccaagttcttcttagtaatttacatttcgtggaaaattatttgctgttactgt
agtcttggttagagtgttattttgtaaagatattttaacttaaaaatgagtatttttcag
ATCCGACATAAAATGTTGAGTTATTTTACTACGCAGTCTTGGAAAACAGCTCAGCAACAT
CTGAGAACAATGAATCATCAAAGTCAGGACTCTAG
gtctgtaataaaaatctgttctgaaaacttttgaatgctacatattcctatattctgaat
gctacagtttttaaaattaatctcattttgtttctgtaataggattaaaaaacttgataa
attccaattcattatcatagaggagctggagaattttgaaaaagattcacagtctttaaa
EXON 39  100 bp
gagttattttactacgcagtcttggaaaacagctcagcaacatctgagaacaatgaatca
tcaaagtcaggactctaggtctgtaataaaaatctgttctgaaaacttttgaatgctaca
tattcctatattctgaatgctacagtttttaaaattaatctcattttgtttctgtaatag
GATTAAAAAACTTGATAAATTCCAATTCATTATCATAGAGGAGCTGGAGAATTTTGAAAA
AGATTCACAGTCTTTAAAAGATTTGGAAAAGGAATTTGTG
gtttgttactttaaaaattttttaaataagtttaaaaccttatttttaaagagctatact
tggaaaaactttcttttttgggagcacatcctaaagctttttgttcagaaaataatttag
ttttatcttagatttctaatcagcttcatagaaacacttttgaagtacgaacttaaattt
EXON 40  59 bp
gagcatatgacatctggaatatttttaacatatagccatactgtttatttaaatttgtaa
taatagaaatagagtaattctactgttggattttaatttttaatcatattaaagtttaac
tggattttattttaggactaaaatatttaggactaaataaaattttattaattaatttag
GACTTTTGGGAAAAGATATTTCAGAAGTTCAGTGCATATCAAAAAAGCGAACAACAGAG
gttagtatgacattcttaatggctataatctataaaattagatttttaaattaataaatt
tctatttgaaaaattaaaattatatatactatattatagcactctaatttgaattattga
taaatacaaggttaactcattattttacttcttaggcttcatcttttgaaaacttcattg
EXON 41  79 bp
catatcaaaaaagcgaacaacagaggttagtatgacattcttaatggctataatctataa
aattagatttttaaattaataaatttctatttgaaaaattaaaattatatatactatatt
atagcactctaatttgaattattgataaatacaaggttaactcattattttacttcttag
GCTTCATCTTTTGAAAACTTCATTGGCTAAAAGTGTCTTCTGTAATACTGATAGTGAAGA
AACTGTTTTTACATCCGAG
gtataaattttatgctttttataggttacctctcttgattacaaaaagaatttgttaatg
taactttgtctttgctgtgaaaactttatggtaaatttcatgggtgaaatatatttactt
ttttacagatgtgtttgatgaaagaagatatgaaagtgctgcaagacaggcttcttaagg
EXON 42  57 bp
taaaagtgtcttctgtaatactgatagtgaagaaactgtttttacatccgaggtataaat
tttatgctttttataggttacctctcttgattacaaaaagaatttgttaatgtaactttg
tctttgctgtgaaaactttatggtaaatttcatgggtgaaatatatttacttttttacag
ATGTGTTTGATGAAAGAAGATATGAAAGTGCTGCAAGACAGGCTTCTTAAGGACATG
gtaagtcaactaagtttgaaaatgggataatcatactttaatgtcttttgtttttgattt
ttttgtgtgtgtgcttttatgtctttctttttcttttgggttgagagaaaatagttttag
cccaattacttttagttctttaaataatgggagcatatttatagtgaaagaataggggta
EXON 43  436 bp
agtaatgatcacagaattctgtggatatctgtagacctgttagaatgcaatatcttcatg
aaagaagttgttttaaaatgaatcactaataacagcttgatttttttttttctattttat
ttggtggttttacagcgaaaatgtgaaatctaagtgtgattttttttttcttggctatag
CTAGAAGAGGAGCTTCTTAATGTACGCAGAGAACTGATGTCAGTATTCATGTCTCATGAA
AGAAATGCTAATGTGTGAAATCTAGTTTTTATCACCATACTTTATCTAATTATTATTCTC
TGTATATAACTGAGGAAATAAGAATAGTCCTACAAAGAGAAAAATATACATGTCACCGAA
GCAAGTGTACCCTTTATAGGAACCCTCAAATTAAAAAAAAATGTCTTTTAATGGATGAGA
GGGAACCACTATAACATGAGTCCAAGCCCAGAAGACTTCTGTCTATACAATATTTTTTTT
TAATTTTGGAGATAAAAGCTTTAAGAAACTTTTTGAGTTAATTATACTCATAAAATGAGT
TTCTTTAATAAATTAAATTTTATTGTGTAAAATGTATTATTACATAAAATGTGTTTTTGA
ATCAATGCAGTTTGGG
gatgaatataattaaaatatgtttaataacttagaattcaactaataaaaatttagccac
acttacaagggggaggaagtccctagtttaaaatgtataactgagtggtagatcagtact
ttcagcacactgttggaaacatttattcagatatggctctaatgtattaggaagcactaa