Gene SRMS Variant 1
DNA : 6.69 KbNT_011333
mRNA : 1517 bp NM_080823
CDS : 1467 bp NP_543013
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  401 bp
gccctgcgccccacccagccccaacgccagcccggacgccggtgggaaccgtgtgcctcc
tggatccaggggacctctgagtgaccgcagggccggggtcccctgtcaccccacggccag
ggcagggagcgctggacaccgggtcccaccggccctgccagttcctcttccgggctcgcg
GGCTCCCATGGCCCTCGGGCCCAGCGTGGTGACCCCGGGGGATGGAGCCGTTCCTCAGGA
GGCGGCTGGCCTTCCTGTCCTTCTTCTGGGACAAGATCTGGCCGGCGGGCGGCGAGCCGG
ACCATGGCACCCCCGGGTCCCTGGACCCCAACACTGACCCAGTGCCCACGCTCCCCGCCG
AGCCTTGCAGCCCCTTCCCTCAGCTCTTCCTTGCGCTCTATGACTTCACGGCGCGGTGTG
GCGGGGAGCTGAGTGTCCGCCGCGGGGACAGGCTCTGTGCCCTCGAAGAGGGGGGCGGCT
ACATCTTCGCACGCAGGCTTTCGGGCCAGCCCAGCGCCGGGCTCGTGCCCATCACCCACG
TGGCCAAGGCTTCTCCTGAGACGCTCTCAGACCAACCGTGA
gtacctcggcctcggagtcagagcctgcctcgcccccagctggggagtccagaacaacgg
caggattttgagttggaaatcgcatgtccgtggctatctgttcattcattcgttcatcca
cgcattcattcagggacagctgatgggccccgggccggcaggtgtggtaggaaaacagca
EXON 2  119 bp
cggcactgggggctgaggcagtgcagaccttgagctgggactcaaagtccacggggtgga
ccttctccctgaggcggtgggacagccgggctcagccctgccggcaacacggaggagagc
atgtggggccactggctgaggggcctgcaaggtgactgccgcacctgctgtttgcagctg
GTACTTTAGCGGGGTCAGTCGGACCCAGGCACAGCAGCTGCTCCTCTCCCCACCCAACGA
ACCAGGGGCCTTCCTCATCCGGCCCAGCGAGAGCAGCCTCGGGGGCTACTCACTGTCAG
gtacctggggcggcccctcctgcctctgtcccccaccaggtcagtggcccttgaccttgg
ggtggttggtctctaggcagtgctggctcctgattcacacccggcgccactgagggccca
acagcagatatgctggtcacctcctgcacttgctaactcacccatttattcattcattca
EXON 3  167 bp
tgccccgccccagcctgtggctgcccacactccctcctccacacagctctgaccatctca
gggtccccagctaggtctgagccagaccccttagtgggttgtggccagcatcctctgggg
tgggagggtcggggcagctggcagccaaggcaggggtctccatctctgaacccttcctag
TCCGGGCCCAGGCCAAGGTCTGCCACTACCGGGTCTCCATGGCAGCTGATGGCAGCCTCT
ACCTGCAGAAGGGACGGCTCTTTCCCGGCCTGGAGGAGCTGCTCACCTACTACAAGGCCA
ACTGGAAGCTGATCCAGAACCCCCTGCTGCAGCCCTGCATGCCCCAG
gtgggcctgtgcctgccaagctgccccatgctgggcccgaggcatggccctgttctaggt
gctcctccccaccccgtcacaaaacccctggggctgtcagaggcgcagctccagggccct
gcccaggcctgggagcatcggagcatcccagcggttccagcacattctgctctctgcggg
EXON 4  142 bp
ctcccacggggctgggccgggcctccaagcctggcacccactcccctttgtcccagccag
ggtggggtgagtgtgtgctggggacaggggtgcccgccagaggcctggtgtggggggctg
tgcctgggacagagcacaggggcccacgctgaccagcctccctgcccaccctccctgcag
AAGGCCCCGAGGCAGGACGTGTGGGAGCGGCCACACTCCGAATTCGCCCTTGGGAGGAAG
CTGGGTGAAGGCTACTTTGGGGAGGTGTGGGAAGGCCTGTGGCTGGGCTCCCTGCCCGTG
GCGATCAAGGTCATCAAGTCAG
gtgaggccccgagatcctgcgccacggccgggccccgcacctgctgtccaaccctcaagc
cccagggcagtgatgttcgtggcgtgggccggtcctggagccacaccctctctcgcagcc
aacatgaagctcactgacctcgccaaggagatccagacactgaagggcctgcggcacgag
EXON 5  159 bp
ggaggtgtgggaaggcctgtggctgggctccctgcccgtggcgatcaaggtcatcaagtc
aggtgaggccccgagatcctgcgccacggccgggccccgcacctgctgtccaaccctcaa
gccccagggcagtgatgttcgtggcgtgggccggtcctggagccacaccctctctcgcag
CCAACATGAAGCTCACTGACCTCGCCAAGGAGATCCAGACACTGAAGGGCCTGCGGCACG
AGCGGCTCATCCGGCTGCACGCAGTGTGCTCGGGCGGGGAGCCTGTGTACATCGTCACGG
AACTCATGCGCAAGGGGAACCTGCAGGCCTTCCTGGGCA
gtgagtcccctccctgctgccacgtggccctgacgcgcctgcgaccgccccttccctcct
ggcgcagagctgaacctgcggggtttccgaggtgaaccgggcctctctaccgggagcagg
tggccccggctgcagatcccatccctgtctggtctccagccaacagggggctggcgtcag
EXON 6  182 bp
tgagtacaggaccctcgccctgtctcacttggggcttcccgtggccttagccggccatgc
catcctcgccacgtcttagagatgaggaggctgaggcatgggggaaggtgacgtgggtgg
acgctggcctcaccggccgttggccccgtgccctaaaagaccccgcgctgtctcctgcag
CCCCCGAGGGCCGGGCCCTGCGTCTGCCGCCACTCCTGGGCTTTGCCTGCCAGGTGGCTG
AGGGCATGAGCTACCTGGAGGAGCAGCGCGTTGTGCACCGGGACTTGGCCGCCCGGAACG
TGCTCGTGGACGACGGCCTGGCCTGCAAGGTGGCTGACTTCGGCCTGGCCCGGCTGCTCA
AG
gtcagcggaggctctgggcccctgacccagagggggtgggtgaggggaccccggtccacc
tgccctaccaggggccttccctcgcccccaggacgacatctactccccgagcagcagctc
caagatcccggtcaagtggacagcgcctgaggcggccaattatcgtgtcttctcccagaa
EXON 7  157 bp
tgcaccgggacttggccgcccggaacgtgctcgtggacgacggcctggcctgcaaggtgg
ctgacttcggcctggcccggctgctcaaggtcagcggaggctctgggcccctgacccaga
gggggtgggtgaggggaccccggtccacctgccctaccaggggccttccctcgcccccag
GACGACATCTACTCCCCGAGCAGCAGCTCCAAGATCCCGGTCAAGTGGACAGCGCCTGAG
GCGGCCAATTATCGTGTCTTCTCCCAGAAGTCAGACGTCTGGTCCTTCGGCGTCCTGCTG
CACGAGGTTTTCACCTATGGCCAGTGTCCCTATGAAG
gtgggtccccaggcagccagagggaggatgcaggctctgcccaggagtcactggccccgg
gcctggacgctgtcggcaaggggttggagggtctggccaagggcaggcagatgacatggg
gggctacaggaggcctcctccatagggacccccaggcagaatcgaggcagctcttgcccc
EXON 8  190 bp
ggcagccagagggaggatgcaggctctgcccaggagtcactggccccgggcctggacgct
gtcggcaaggggttggagggtctggccaagggcaggcagatgacatggggggctacagga
ggcctcctccatagggacccccaggcagaatcgaggcagctcttgccccgcgcctcccag
GGATGACCAACCACGAGACGCTGCAGCAGATCATGCGAGGGTACCGGCTGCCGCGCCCGG
CTGCCTGCCCGGCGGAGGTCTACGTGCTCATGCTGGAGTGCTGGAGGAGCAGCCCCGAGG
AACGGCCCTCCTTCGCCACGCTGCGGGAGAAGCTGCACGCCATCCACAGATGCCACCCCT
GAGTCCTCAC
gtgacccaacgctctgggctccagccaggccagcccctcctccctgcagagcgccaactc
gaagggatgccggtctgccggaccgaggagcctctggctgtgggcctcaggccctggcgt
gcacacatgttcgtgcaccaggcagacgtgcagacggagggctggggctgacgtcccccg